Screen of Bovine Mammary Gland Epithelial Cell Specifcity Promotor

Liu Xiao-fei ,Li Qing-zhangQiu You-wenand Gao Xue-jun*

1 Key Laboratory of Dairy Science of Education Ministry,Northeast Agricultural University,Harbin 150030,China

2 Key Laboratory for Food Science and Engineering,Harbin University of Commerce,Harbin 150076,China

Introduction

Improving the level of gene expression either in vitro or in vivo remained as an unfulfilled task.Many bacterial and viral promotors have been exploited for construction of expression vectors.However,very few mammalian promotors have been tried for eukaryotic expression and also for transgenic purpose.Foreign proteins can be synthesized in the milk of farm animals by fusion of promotor elements from the milk protein genes with the coding sequence of the proteins of interest to direct expression to the mammary gland (John et al.,1999).Importantly,the mammary gland is capable of carrying out almost all the complex post-traslational modifications (Castilla et al.,1998;Prunkard et al.,1996;Karatzas and Turner,1997).The content of α-S1-casein is about 13 g • L-1,and higher than other proteins in milk,which was cloned and used as promotor by many scholars (Ramunnoa et al.,2004;Bhure and Sharma,2007;Tan et al.,2001;Toman et al.,1999).The results of this study provided important evidence for its suitability for the construction of an inducible eukaryotic expression vector and also provided required information for transgenic studies.

Materials and Methods

Materials

pGL3-Basic vector;phRL-TK vector;pcDNA3.1+ vector and dairy cow mammary gland epithelial cells (DCMECs) L140d (conserved in our laboratory).

Main reagents and instruments

Fetal bovine serum (Gibco);FuGENE HD tansfection reagent (Roche);pMDTM-18T (TaKaRa);T4DNA ligase (NEB);Dual-Luciferase®Reporter Assay System(Promega);Endo-free plasmid mimi kitⅡ(OMGEA);Luminometer FB12 (Berthold);gradient PCR (Biometra).

Screening method of bovine lactoprotein 5'regulatory sequence

To screen an effective bovine lactoprotein 5'regulatory sequence,the main lactoproteins (α-S1-casein,β-lactoglobulin,and β-casein) were selected in this study.The full-length of each DNA fragment was amplificated by PCR,and primers were as the followings.α-S1-casein: forward primer 5'-CGGGGTACCAATGTTGAAT GGGAAGGAC -3'(BglⅡ) and reverse primer 5′-C GAGCTCATGTGCTTGCCTTTATGG-3'(NheⅠ),β-lactoglobulin: forward primer 5'-ATCGACGCG TCATACTCAGCGACACACCCAG -3'(Mlul) and reverse primer 5'-ACTAG CTAGCCATGGCCAAGG AGTACCAAGT -3'(NheⅠ),β-casein: forward primer 5'-TGGTACCTTGCAGGAAAAAGATTAGACCA C-3'(Kpnl) and reverse primer 5'-AGAGCTCCAC AAGACAGGTAAGGATGAGAA -3'(SacⅠ).PCR was performed under the same following conditions: after denaturation at 94℃ for 5 min,DNA amplification was performed for 35 cycles at 94℃ for 45 s,at 67℃ for 1 min and 72 for 2 min,with a final extension at 72℃ for 5 min and then was kept at 4℃.

PCR products were respectively cloned to pMD18-T,which were α-S1-T β-lactoglobulin-T and β-casein-T.Each identificated PCR product was cloned to pGL3-Basic vector which had luciferase reporter gene (report gene),then pGL3-Basic-αS1,pGL3-Basic-β-lactoglobulin and pGL3-Basic-β-casein were obtained.To select the best one,each of the three recombinant plasmids was respectively transfected into the DCMECs and fibroblast cells,and the FuGENE®HD transfection reagent was used following the manufacturer's protocol.At 24 h after transfection,the expression level of dual luciferase reporter gene was detected by chemiluminescence detection following the manufacturer's protocol.In this step,both untransfected cells and pGL3-Basic vector-only transfected cells were used as the control.

Results

PCR products of lactoprotein 5'regulation sequences

The 5'flanking regulatory regions of lactoprotein genes were amplified by PCR.Only one band was found on the gel,and each product was almost identical in size to PCR product estimated from the nucleotide sequence (Fig.1).

The vectors of α-S1-T,β-lactoglobulin-T and β-casein-T were constructed,and then successfully conducted by restriction digestion.The results showed that there were two right bands in the predicted size (Fig.2).

Fig.1 PCR results of lactoprotein genes

Fig.2 Double-enzyme digestion of lactoprotein-T

Identification of pGL3-Basic-lactoprotein

PCR products of lactoprotein were cloned into pGL3-Basic vector respectively,they were pGL3-Basic-αS1,pGL3-Basic-β-lactoglobulin,and pGL3-Basic-β-casein,and then these recombinant plasmids were identified by different enzymes.The results showed that the bands were corrected to the predicted sizes (Fig.3).

Fig.3 Double-enzyme digestion of pGL3-Basic-lactoprotein

Detection of report gene expression

The recombinant plasmids pGL3-Basic-lactoprotein were respectively tranfected into the DCMECs and collagenoblasts,and empty vectors were used as negative controls.The activities of recombinant plasmids were estimated by luciferase expression.Luciferase expression of pGL3-Basic-lactoprotein was obviously higher than that of the negative controls in the DCMECs,but was rather low and similar with negative controls in collagenoblasts (Fig.4).It was identified that pGL3-Basic lactoprotein expressed specifically in the DCMECs,and luciferase activity of pGL3-Basic-αS1 was the highest.In other words,the promotor activity of bovine αS1-casein gene was the best selection in this experiment.

Promotors of milk protein genes were frequently used to produce medically important proteins in the mammary gland of transgenic animals and to construct an eukaryotic expression vector.The caseins are the major milk proteins of mammals,such as α-S1-casein,β-lactoglobulin,and β-casein.Compared to 5'region,the results showed that the activity of α-S1-casein 5'sequence regions was the highest.This result was related to the content of α-S1-casein,which was about 13 g • L-1,higher than other proteins in bovine milk (Mercier and Vilotte,1993).Otherwise,many scholars thought that all the constructs prepared contain core promotor elements,milk specific transcription factor sequence,prolactin,progesterone responsive elements and one glucocorticoid responsive element.In addition,all the constructs also contained exon I sequence (Sanjeevkumar and Bhaskar,2007).α-S1-casein 5'sequence regions contained two TATA boxes(TTTAAAT) ,milk box (TCTCCTTAGAATTTCTTG GG),milk protein binding factor (AATTCTTAGAA TT) and mammary gland specific transcriptional factor (AATTCTTAGAATT),which might be responsible for the increase in expression level.α-S1-casein gene promotor was found to be useful for eukaryotic vector construction.

Fig.4 Detection of report gene expression by a fluorescence detector

Conclusions

The activity of α-S1-casein5'flanking sequence regions was the highest in the three bovine milk protein 5'regulatory sequences,which identified that it is important to produce pharmaceutically and medically important proteins in the mammary gland of transgenic animals,and can be used to construct inducible eukaryotic expression vector.

Bhure S,Sharma B.2007.Cloning and characterization of ovine aS1-casein gene promotor: a transfection study in rat mammary gland cell line.DNA Sequence,18(1): 39-46.

Castilla J,Pintado B,Sola I,et al.1998.Engineering passive immunity in transgenic mice secreting virus-neutralizing antibodies in milk.Nat Biotechnol,16: 349-354.

John D C,Watson R,Kind A J,et al.1999.Expression of an engineered form of recombinant procollagen in mouse milk.Nat Biotechnol,17(4): 385-389.

Karatzas C N,Turner J D.1997.Toward altering milk composition by genetic manipulation: current status and challenges.J Dairy Sci,80(9): 2225-2232.

Mercier J C,Vilotte J L.1993.Structure and function of milk proteingenes.Dairy Sci,76(10): 3079-3098.

Prunkard D,Cottingham I,Garner I,et al.1996.High-level expression of recombinant human fibrinogen in the milk of transgenic mice.Nat Biotech,14(7): 867-871.

Ramunnoa L,Cosenzaa G,Randob A,et al.2004.The goat as1-casein gene: gene structure and promotor analysis.Gene,334: 105-111.

Tan X H,Cheng X,Zhou J,et al.2001.Bovine alpha-S1-casein gene sequences direct expression of a variant of human tissue plasminogen activator in the milk of transgenic mice.Journal of Genetics and Genomics,28(5): 405-410.

Toman P D,Pieper F,Sakai N,et al.1999.Production of recombinant human type I procollagen homotrimer in the mammary gland of transgenic mice.Transgenic Res,8(6): 415-427.