Long noncoding RNA lnc_217 regulates hepatic lipid metabolism by modulating lipogenesis and fatty acid oxidation

Xiaoqing Yuan, Yawei Liu, Xule Yang, Yun Huang, Xuan Shen, Hui Liang, Hongwen Zhou,Qian Wang, Xu Zhang,✉, John Zhong Li,✉

1The Key Laboratory of Rare Metabolic Disease, Department of Biochemistry and Molecular Biology, the Key Laboratory of Human Functional Genomics of Jiangsu Province, Key Laboratory of Targeted Intervention of Cardiovascular Disease, Collaborative Innovation Center for Cardiovascular Disease Translational Medicine, Nanjing Medical University, Nanjing, Jiangsu 211166, China;

2Department of General Surgery, the First Affiliated Hospital of Nanjing Medical University, Nanjing, Jiangsu 210029,China;

3Department of Endocrinology, the First Affiliated Hospital of Nanjing Medical University, Nanjing, Jiangsu 210029,China.

Abstract Nonalcoholic fatty liver disease (NAFLD) is considered a major health epidemic with an estimated 32.4%worldwide prevalence.No drugs have yet been approved and therapeutic nodes remain a major unmet need.Long noncoding RNAs are emerging as an important class of novel regulators influencing multiple biological processes and the pathogenesis of NAFLD.Herein, we described a novel long noncoding RNA, lnc_217, which was liver enriched and upregulated in high-fat diet-fed mice, and a genetic animal model of NAFLD.We found that liver specific knockdown of lnc_217 was resistant to high-fat diet-induced hepatic lipid accumulation and decreased serum lipid in mice.Mechanistically, we demonstrated that knockdown of lnc_217 not only decreased de novo lipogenesis by inhibiting sterol regulatory element binding protein-1c cleavage but also increased fatty acid βoxidation through activation of peroxisome proliferator-activated receptor α and carnitine palmitoyltransferase-1α.Taken together, we conclude that lnc_217 may be a novel regulator of hepatic lipid metabolism and a potential therapeutic target for the treatment of hepatic steatosis and NAFLD-related metabolic disorders.

Keywords: NAFLD, lncRNA, de novo synthesis, β-oxidation

Introduction

Nonalcoholic fatty liver disease (NAFLD) has emerged as a significant public health problem,paralleling the dramatic escalation in the global prevalence of obesity.NAFLD affects about 32.4% of people worldwide, with prevalence rates varying from 13% in Africa to 42% in Southeast Asia[1].By 2030,the number of NAFLD cases in China is predicted to increase to 314.58 million, which is the fastest growth in the prevalence of NAFLD globally[2].Currently,there are no licensed drug treatments available for NAFLD, although there have been many drugs in the pipeline that are reckoned as good candidates to cure NAFLD/nonalcoholic steatohepatitis[3].There is an unmet need to use natural products to cure or alleviate NAFLD by physicians[4].

The pathophysiology of NAFLD has not been elucidated.However, it is known to develop when the influx of lipids traveling into the liver (i.e., fatty acid uptake andde novolipogenesis [DNL]) exceeds hepatic lipid disposal (i.e., mitochondrial fatty acid oxidation and exportation as a component of very low-density lipoprotein [VLDL] particles).Studies reported that hepatic DNL made up about one-third of the total triglyceride content in the liver of NAFLD patients with hyperinsulinemia[5–6].Sterol regulatory element binding protein-1c (SREBP-1c) is a key lipogenic transcription factor, which directly activates the expression of more than 30 proteins, including fatty acid synthase (FAS) and acetyl-CoA carboxylase(ACC), and is involved in fatty acid and triglyceride synthesis[7].Several lines of evidence implied that hyperinsulinemia, which predominated in the insulinresistant state, stimulated lipogenesis by activating SREBP-1c, causing NAFLD in humans and animal models[8–9].During starvation, the body is powered mainly by adenosine triphosphate through β-oxidation of fatty acids, and this process was found to be modulated by carnitine palmitoyltransferase-1A (CPT-1A), a rate-limiting enzyme playing a crucial role in controlling fatty acyl-coA shuttle from the cytosol into mitochondrial matrix, where fatty acyl-coA underwent β-oxidation to produce energy in the form of adenosine triphosphate[10].Moreover, transcription factor peroxisome proliferator-activated receptor α(PPARα) was reported to promote the transcription of CPT-1 to activate fatty acid β-oxidation and the generation of ketone bodies[11].During starvation or fasting, one study showed that the defects in thePparαgene led to hepatic steatosis and the development of hypoketosis and hypoglycemia in mice[12].Of note, in previous studies, SREBP-1c expression decreased in PPARα-null mice, compared with wild-type mice[13], and PPARα agonists enhanced the activity of the SREBP-1c promoter through direct binding with its DR1 motif[14].Others reported that malonyl-CoA produced by ACC inhibited the activity of CPT-1, and thereby decreased the rate of βoxidation by reducing fatty acid transport to mitochondria[15–16].

Long non-coding RNAs (lncRNAs) are a type of RNA, generally defined as transcripts more than 200 nucleotides that are not translated into protein[17–18].Similar to protein-coding genes, many lncRNAs are restricted in the tissue distribution[19].Recent studies have demonstrated that lncRNAs are essential for fatty acid biosynthesis, oxidation, and VLDL secretion in the liver[20–22].For example,lncHR1was reported to be involved in the activation of SREBP-1c to regulate hepatic fatty acid synthesis[23].Up-regulated long noncoding RNA (HULC) was found to target PPARα to regulate lipid deposition in hepatocellular carcinoma[24].Therefore, to further identify new lncRNAs that regulate hepatic lipid metabolism is of great importance.

To explore new non-coding RNA related to liver lipid metabolism, we analyzed an existing RNA-seq dataset (GSE157482) from the livers of high-fat diet(HFD) and normal diet (ND) mice and identified a novel lipid-induced lncRNA,lnc_217.To investigate its function, we performed gain and loss of function experiments to manipulatelnc_217expression levelsin vivoandin vitro, based on adenovirus transduction and plasmid transfection, to clarify the role of a novel lncRNA in hepatic fatty acid metabolism, and to provide a new potential therapeutic target for the treatment of hepatic steatosis and NAFLD-related metabolic disorders.

Materials and methods

Experimental animals

C57BL/6J mice used in the current study were purchased from the Model Animal Research Center of Nanjing University (MARC, Nanjing, Jiangsu, China).All of the mice were maintained in a 12-h light/dark cycle at 25 ℃ with free access to rodent chow and water in the animal facility (specific-pathogen free) of Nanjing Medical University.All the procedures followed the guidelines for the care and use of animals established by Nanjing Medical University (IACUC-1601211).

Cell culture and transfection

293A and Hepa1-6 cells were purchased from the American Type Culture Collection (ATCC, Manassas,VA, USA) and maintained in high-glucose DMEM(Life Technologies, Gaithersburg, MD, USA)containing 10% FBS (Gibco, Waltham, MA, USA)and 1% penicillin-streptomycin.The full-lengthlnc_217expression vectors with Myc-Tag were amplified by PCR from C57BL/6J mouse liver cDNA.The specific primers were listed as follows:lnc_217-F: 5′-GTGCCAGACTACGCAGGATCCATGCTCAT CATCTTGCCTCTGGG-3′;lnc_217-R: 5′-CGCCTC GAGAAGCTTGGATCCGTGGCTTTCCTGTGCAC GTGTTG-3′;lnc_217-T-R: 5′-CGCCTCGAGAAGC TTGGATCCTGTGGCTTTCCTGTGCACGTGTTG-3′;lnc_217-TT-R: 5′-CGCCTCGAGAAGCTTGGATC CTTGTGGCTTTCCTGTGCACGTGTTG-3 ′.Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) was used for transient transfection in 293A and Hepa1-6 cells according to the manufacturer's instructions.

Adenovirus-mediated knockdown of lnc_217 in mice

Adenovirus of Ad-scramble or Ad-shlnc_217was generated by the AdEasy system (shlnc_217target sequences: 5′-CTAAGCATGACAAATCACT-3′, 3′-AGTGATTTGTCATGCTTAG-5′) and injected (n=6/group, 2.5 × 1011particles/mouse)viatail veins of 8–10-week-old C57BL/6J mice.After injection, mice were given either an ND or an HFD (60% kcal from fat, D12492, Research Diets, New Brunswick, NJ,USA) for seven days.After a 16-h fast, the mice were then euthanatized, and the liver and blood were harvested.

Mouse primary hepatocyte isolation and treatment

Mouse primary hepatocytes were isolated in a previously mentioned manner[21].Hepatocytes were cultured in a low glucose medium (Gibco) with 10%FBS supplement in 6-well plates at a density of 4 × 105cells per well.Adenovirus was applied to primary hepatocytes (6 × 109particles/well) for 6 h.Following a 16-h incubation period with or without 200 μmol/L oleic acid, cells were harvested.

Real-time reverse transcription PCR (RT-qPCR)

The livers were immediately frozen in liquid nitrogen, and RNA was isolated using Trizol(Invitrogen), according to the manufacturer's instructions.The cDNA synthesis and quantitative PCR with the indicated primers (Supplementary Table 1, available online) were performed as described.RNA expression levels were normalized toActbas the internal control and to the control group using the 2-ΔΔCtmethod, calculated as arbitrary units,and represented as mean ± standard deviation.The data of the expression levels oflnc_217in different tissues of C57BL/6J mice were expressed as mean.

Western blotting

Fresh tissues or cells were harvested and lysed in RIPA buffer supplemented with a complete protease inhibitor cocktail (Roche Diagnostics Deutschland GmbH, Mannheim, Germany), and their protein concentration was subsequently determined by the BCA assay.Then, SDS-PAGE and wet transfer were performed.The membranes were blocked with 5%milk and then incubated with the indicated primary antibodies followed by HRP-conjugated secondary antibody.Proteins were visualized using Super-Signal ECL (Biotanon, Shanghai, China).The following antigens were targeted by the use of antibodies:anti-SREBP-1c (1∶1 000; Cat.#ab28481, Abcam,Cambridge, UK), anti-PPAR (1∶1 000; Cat.#ab24509, Abcam), anti-CPT1α (1∶1 000; Cat.#CPT1L12-A, Alpha Diagnostic, San Antonio, TX,USA), anti-UCP2 (1∶1 000; Cat.#ab67241, Abcam),and Calnexin (1∶3 000; Cat.#ADI-SPA-860, ENZO Life Sciences, Farmingdale, NY, USA).Protein levels were normalized to calnexin as the internal control and to the control group.

Liver and plasma lipids analysis

Liver lipids were extracted from 100–200 mg of frozen liver samples using the Folch and Lees'method.Triglyceride, total cholesterol and free fatty acid were measured using enzymatic kits (Wako,Richmond, VA, USA) and normalized to sample weight.Plasma triglyceride, total cholesterol and free fatty acid were measured using the same enzymatic assays.

Oil red O staining

Liver sections were embedded in liquid nitrogen and transversely sectioned into 10-μm frozen sections for oil red O staining.Stained sections were analyzed using ImageJ software (NIH, http://rsb.info.nih.gov/ij/).We opened the raw image and split it into three color-channels with "Split channels".The blue channel, which highlighted its raw oil-red staining,was chosen to set an appropriate threshold.Threshold values were determined empirically by selecting a setting that gave the most accurate binary image for a subset of randomly selected photomicrographs with varying peptides densities.Then, the resulting image was measured by "Area fraction" measurements.Six slices were analyzed per group.

5′ and 3′ rapid amplification of cDNA ends (RACE)

To identify the full-length sequence oflnc_217, the GeneRacer Kit (Invitrogen) was used to perform 5′ and 3′ cDNA terminal rapid amplification tests according to the manufacturer's protocol.For thelnc_217RACE assay, sequences in the mouse genome were retrieved from the NCBI database using the Basic Local Alignment Search Tool, and confirmed by RT-PCR using forward (5′-GGTTAGGACCCGTCAG-3′) and reverse (5′-CAGTGAGCGAGTCTATTT-3′) primers and sequencing.From the sequencing results, 5′ and 3′RACE primers were designed.The sequences of genespecific primers were 5′-ACTCATCATCTTGCCTCT GGGAATC-3′ (5′ RACE) and 5′-GCCTCACTGTTT TGCCTGGTG-3′ (3′ RACE).

Fig. 1 Identification of a novel long non-coding RNA (lncRNA) implicated in hepatic lipid metabolism.A: Relative expression of lnc_217 in mouse tissues (three samples pooled together per tissue).Tissue samples from three C57BL/6J mice were harvested for RNA extraction and pooled for reverse transcription to obtain a set of tissue cDNA.Total RNA was subjected to real-time reverse transcription PCR (RT-qPCR), and the levels of lnc_217 in tissues were expressed relative to the testis.Data are expressed as the mean.B: RT-qPCR analysis of relative lnc_217 expression in the liver of C57BL/6J mice fed with a normal diet (ND) or a high-fat diet (HFD) for four weeks (n= 6/group).C and D: RT-qPCR analysis of relative lnc_217 expression in the livers of ob/ob (C) and db/db (D) mice(n = 6/group).lnc_217 expression levels were normalized to Actb as the internal control and to the control group.Data are expressed as the mean and standard deviation (B–D).Statistical analyses were performed by Student's t-test for two-group comparisons (B–D).*P < 0.05 and**P < 0.01.Abbreviations: BAT, brown adipose tissue; gWAT, white adipose tissue of the groin; SM, skeletal muscle.

RNA fluorescence in situ hybridization (RNA-FISH)

Lnc_217was detected by RNA-FISH in mouse hepatocytes.Cell slides fixed with 4%paraformaldehyde were treated with several buffers in the RNA-FISH Kit (Ri-boBio, Guangzhou, China).After denaturation at 37 ℃ for 5 min, the probe mixture was hybridized overnight in cell slides at 37 ℃in the dark.CY3-labeled Locked Nucleic Acid probes targetedlnc_217.After washing, the signal was observed under a confocal microscope.

Statistical analysis

Statistical analysis was performed by GraphPad Prism 7.Results were presented as the mean and standard deviation of at least three independent experiments as indicated in the figure legends.A twotailed Student'st-test was used to calculate the statistical significance of different groups.A two-way ANOVA was used for statistical analysis inSupplementary Fig.2(available online).Statistical results were considered significant whenP< 0.05.

Results

Identification of a novel lncRNA implicated in hepatic lipid metabolism

To identify novel lncRNAs potentially involved in hepatic lipid metabolism, we analyzed a previously published RNA-seq dataset (GSE157482) from the livers of HFD and ND mice[21].Among the altered lncRNAs, we found that the expression oflnc_217was enriched in the mouse liver (Fig.1A) and significantly increased in the liver of the HFD mice(Fig.1B).In addition to the HFD mouse model,ob/obanddb/dbmice are important genetic mouse models of NAFLD.The hepatic expression levels oflnc_217were significantly increased in these two NAFLD mouse models (Fig.1C–1D).Taken together,lnc_217is regulated by nutritional status and may be correlated with the pathogenesis of hepatic steatosis.

Fig. 3 Knockdown of lnc_217 reduced hepatic lipid accumulation and hyperlidiaemai in high-fat diet fed (HFD) mice.C57BL/6J male mice (six to eight weeks old) were infected with 2.5 × 1011 recombinant adenovirus particles of Ad-Scramble (Adcon) or Ad-shlnc_217 via tail vein injection and fed with a normal diet (ND) or HFD for seven days.Mice were sacrificed and the tissues and plasma were collected for analysis after 16 h fasting (n = 5/group).A: Real-time reverse transcription PCR analysis of the knockdown efficiency of lnc_217 in the liver.lnc_217 expression levels were normalized to Actb as the internal control and to the control group.B: Body weight analysis of the two groups of mice.C: Analysis of the liver-to-body weight ratio of the two groups of mice.D: Comparison of blood glucose in the two groups of mice.E: Representative images of oil red O staining of liver sections from control and lnc_217 knockdown mice (n =3/group), scale bar, 50 μm.F–H: Total hepatic triglyceride (TG) (F), total cholesterol (TC) (G), and free fatty acid (FFA) (H) were extracted from the livers of Adcon and lnc_217 knockdown (Ad-shlnc_217) mice and measured using enzymatic kits.I–K: Serum TG (I), FFA (J), and TC (K) levels were measured using enzymatic kits.Data are expressed as the mean and standard deviation from three independent experiments.Statistical analyses were performed by Student's t-test for two-group comparisons.*P < 0.05 and **P < 0.01.

Prediction and verification of the encoding ability of lnc_217

The results of the RACE assay revealed a fulllength of 2 978 nt forlnc_217located on chromosome 7 of mice (Supplementary Fig.1Aand1B, available online), which was highly conserved from mice to humans.According to the prediction of the Coding Potential Calculator online prediction system(http://cpc.gao-lab.org/),lnc_217lacks coding potential, similar to known lncRNAs, such aslncLSTRandlncBATE1(Fig.2A).In addition, the full-lengthlnc_217expression vectors with Myc-Tag were constructed and transfected into 293A cells to further elucidate protein coding potential (Fig.2B).All the vectors were transcribed but failed to produce protein(Fig.2Cand2D).These results confirmed thatlnc_217lacked the ability to encode proteins.RNAFISH analysis further revealed thatlnc_217was enriched in the cytosol fraction of primary hepatocytes and Hepa1-6 hepatocytes with a similar expression pattern to 18S ribosomal RNA, a positive control marker for the cytosol fraction (Fig.2Eand2F).These results suggest thatlnc_217is a lncRNA localized in the cytosol without the protein coding ability.

Liver-specific knockdown of lnc_217 reduced hepatic lipid accumulation and hyperlipidaemia in HFD-fed mice

To investigate physiological functions oflnc_217in the hepatic lipid metabolism, we generated liverspecificlnc_217-knockdown mice by tail vein injection with adenoviral-mediated shRNA (Fig.3A)and then fed the mice an HFD.As shown inFig.3B,there was no significant difference in the body weight(Fig.3B) or the liver index (Fig.3C) between thelnc_217knockdown group and the control group.There was also no statistically significant difference in the blood glucose levels between the two groups of mice (Fig.3D).These findings suggest that liverspecificlnc_217knockdown may not cause disturbances in the glucose metabolism.

Fig. 4 Liver-specific knockdown of lnc_217 decreased hepatic lipogenesis and increased fatty acid β-oxiation in mice.A: Relative mRNA levels of genes involved in lipogenesis in the livers of Ad-Scramble (Adcon) and lnc_217 knockdown (Ad-shlnc_217) mice under normal diet (ND) or high-fat diet (HFD) conditions (n = 4/group).mRNA levels were normalized to Actb as the internal control and to the control group.B and C: Western blotting analysis of protein levels of SREBP-1c (B) and the of genes involved in β-oxidation (C) from the same livers (n = 3/group).P and C indicate precursor and cleavage forms of SREBP-1c, respectively.Protein levels were normalized to calnexin as the internal control and to the control group.D: Serum ketone body content was measured using enzymatic kits (n = 5/group).Data are expressed as the mean and standard deviation from three independent experiments.Statistical analyses were performed by Student's t-test for two-group comparisons.*P < 0.05 and **P < 0.01.Abbreviations: SREBP-1c, sterol regulatory element binding protein-1c; PPARα,peroxisome proliferator-activated receptor α; CPT-1A, carnitine palmitoyltransferase 1A; UCP2, uncoupling protein 2.

Fig. 5 Knockdown of lnc_217 decreased lipogenesis and increased fatty acid β-oxidation in primary hepatocytes.A: Knockdown efficiency of lnc_217 in Hepa1-6 cells by real-time reverse transcription PCR analysis (n = 3/group).B: Intracellular triglyceride (TG) levels in lnc_217 knockdown primary hepatocytes with or without oleic acid (OA) treatment (n = 3/group).C: Relative mRNA levels of lipogenic genes in lnc_217 knockdown primary hepatocytes with or without OA treatment (n = 3/group).D: Western blotting analysis of protein levels of SREBP-1c in lnc_217 knockdown primary hepatocytes with or without OA treatment (n = 3/group).P and C indicate precursor and cleavage forms of SREBP-1c, respectively.E and F: Relative mRNA (E) and protein (F) levels of genes involved in β-oxidation in lnc_217 knockdown primary hepatocytes with or without OA treatment.mRNA levels were normalized to Actb as the internal control and to the control group.Protein levels were normalized to calnexin as the internal control and to the control group.Data are expressed as the mean and standard deviation from three independent experiments.Statistical analyses were performed by Student's t-test for two-group comparisons.*P < 0.05, **P < 0.01, and ***P < 0.001.Abbreviations: SREBP-1c, sterol regulatory element binding protein-1c; PPARα, peroxisome proliferator-activated receptor α; CPT-1A, carnitine palmitoyltransferase 1A; UCP2, uncoupling protein 2.

To further evaluate biological functions oflnc_217in the hepatic lipid metabolism, oil red O staining of mouse liver sections was performed.The results showed that the knockdown oflnc_217significantly inhibited HFD-induced lipid accumulation in the liver(Fig.3E).Consistently, the hepatic triglyceride level was significantly reduced in liver-specificlnc_217knockdown mice, compared with that in the control group with HFD challenge (Fig.3F).However, we found that the knockdown oflnc_217did not change hepatic cholesterol as well as free fatty acid levels(Fig.3Gand3H).The results of further biochemical analysis of mouse serum revealed that the knockdown oflnc_217significantly decreased serum triglyceride and free fatty acid levels after HFD feeding (Fig.3Iand3J), without affecting serum total cholesterol levels (Fig.3K).Taken together, the knockdown oflnc_217ameliorates HFD-induced liver lipid accumulation and hyperlipidemia in mice.

Liver-specific knockdown of lnc_217 decreased liver fatty acid synthesis and increased β-oxidation

Hepatic lipid homeostasis is mainly coordinated by DNL, fatty acid β-oxidation, and VLDL secretion.We first performed a VLDL-triglyceride secretion assay by injection of tyloxapol to verify the regulatory role oflnc_217on hepatic lipid secretionin vivo.As shown inSupplementary Fig.2A(available online),the knockdown oflnc_217did not alter VLDL secretion.

Fig. 6 Overexpression of lnc_217 increased lipogenesis and decreased fatty acid β-oxidation in Hepa1-6 cells.A: Overexpression efficiency of lnc_217 in Hepa1-6 cells by real-time reverse transcription PCR analysis (n = 3/group).B: Intracellular triglyceride (TG) levels in lnc_217 overexpressed Hepa1-6 cells with or without oleic acid (OA) treatment (n = 6/group).C: Relative mRNA levels of lipogenic genes in lnc_217 overexpressed cells with or without OA treatment (n = 6/group).D: Western blotting analysis of protein levels of SREBP-1c in lnc_217 overexpressed-cells with or without OA treatment (n = 6/group).P and C indicate precursor and cleavage forms of SREBP-1c,respectively.E and F: Relative mRNA (E) and protein (F) levels of genes involved in β-oxidation in lnc_217 overexpressed Hepa1-6 cells with or without OA treatment.mRNA levels were normalized to Actb as the internal control and to the control group.Protein levels were normalized to calnexin as the internal control and to the control group.Data are expressed as the mean and standard deviation from three independent experiments.Statistical analyses were performed by Student's t-test for two-group comparisons.*P < 0.05, **P < 0.01, and***P < 0.001.Abbreviations: SREBP-1c, sterol regulatory element binding protein-1c; PPARα, peroxisome proliferator-activated receptor α;CPT-1A, carnitine palmitoyltransferase 1A; UCP2, uncoupling protein 2.

Importantly, the RT-qPCR results showed that liver-specific knockdown oflnc_217significantly repressed hepatic expression of key genes involved in DNL, such asSrebp-1c,Fas(the gene encoding tumor necrosis factor receptor superfamily member 6), andAcaca(the gene encoding acetyl-CoA carboxylase 1)(Fig.4A).We further measured the protein level of SREBP-1c in the livers of these mice and found that manipulation oflnc_217did not change the precursor level of SREBP-1c; however, the cleavage form of SREBP-1c protein level significantly decreased in the liver oflnc_217knockdown mice with an HFD (Fig.4B).These results suggest that the knockdown oflnc_217decreases SREBP-1c expression and cleavage to inhibit hepatic fatty acid synthesis.

Furthermore, we observed that the protein levels of PPARα, CPT-1A and UCP2 were significantly induced in the liver of mice with the depletion oflnc_217(Fig.4C).Consistently, the serum level of βhydroxybutyrate, a major ketone body generated by fatty acid β-oxidation in the liver, was significantly increased in thelnc_217knockdown mice after HFD feeding (Fig.4D).These results suggest that the knockdown oflnc_217promotes fatty acid βoxidation in the liver.

Knockdown of lnc_217 decreased fatty acid synthesis and increased β-oxidation in primary hepatocytes

To confirm that the decrease in liver triglyceride in thelnc_217knockdown mice was cell autonomous,we further investigated biological consequences of thelnc_217knockdown on the lipid metabolism in primary hepatocytes infected with Ad-shlnc_217(Fig.5A).As shown inFig.5B, the triglyceride levels were reduced by about 40% in hepatocytes after knockdown oflnc_217in the presence of oleic acid.Consistent with the observations in mice liver, the mRNA levels of genes involved in lipogenesis, such asSrebp-1c,Fas,Acc1, andScd1(the gene encoding acyl-CoA desaturase 1), markedly declined inlnc_217-knockdown hepatocytes with oleic acid treatment (Fig.5C).The cleavage of SREBP-1c was also reduced (Fig.5D).In addition, the expressions of PPARα and CPT-1A were significantly upregulated in both mRNA (Fig.5E) and protein levels (Fig.5F).These data suggest that the reduced lipid contents inlnc_217knockdown hepatocytes result directly from a combination effect of the reduced DNL and the increased fatty acid β-oxidation.

Overexpression of lnc_217 increased lipogenesis and decreased fatty acid β-oxidation in Hepa1-6 cells

Apart from the knockdown experiments, we overexpressedlnc_217in Hepa1-6 cells.In agreement with the knockdown result, the overexpression oflnc_217resulted in a significant accumulation of triglycerides following oleic acid treatment (Fig.6Aand6B).Furthermore, the mRNA levels of lipogenic genes, includingSrebp-1c,Fas,Acc1andScd1,markedly increased in thelnc_217-overexpressed cells(Fig.6C), and the cleavage of SREBP-1c was also elevated (Fig.6D).In addition, the expression levels of fatty acid oxidation genes (PparaandCpt1a) were significantly downregulated (Fig.6Eand6F).These data suggest that the overexpression oflnc_217may directly induce hepatic steatosis.Based on the results from the knockdown and overexpression experiments,we concluded thatlnc_217regulated the hepatic lipid metabolism by modulating lipogenesis and fatty acid oxidation.

Discussion

Given the prevalence of NAFLD, its associated complications, and its lack of effective treatment options, the understanding of hepatic fatty acid metabolism is a vital research priority as we strive to find effective prevention or therapeutic strategies for NAFLD[25].NAFLD stems from a disequilibrium between hepatic fatty acid influx and disposal.The choice of interventional targets is challenging due to the existence of feedback mechanisms among fatty acid absorption, esterification, oxidation and secretion[26].LncRNAs are emerging as an important class of novel regulators influencing multiple biological processes and the pathogenesis of metabolic diseases[27–28].In the current study, we demonstrated that a novel lncRNA,lnc_217, may be a potential therapeutic target for NAFLD, as it effectively balanced the low synthesis and high consumption of fatty acids in the liver.

Various conditions lead to hepatic steatosis in the liver.In the current study, experiments with primary hepatocytes could exclude the uptake of free fatty acids from serum by hepatocytes.A tyloxapol-induced VLDL secretion experiment ruled out triglyceride secretion.It is well known that enhanced activation of SREBP-1c is closely associated with the development of hepatic steatosis and dyslipidemia.The suppression of SREBP-1c cleavage has been proven to be an effective approach to improve fatty liver in mice.The knockdown oflnc_217reduces cleavage of SREBP-1c, as well as the transcription of its target genes.Thus, the knockdown oflnc_217decreases hepatic steatosis by inhibiting DNL of fatty acids.On the other hand,lnc_217knockdown increases the levels of PPARα, CPT-1A and UCP2, which are key regulators of β-oxidation, bothin vitroandin vivo.In agreement with this observation,lnc_217knockdown increases the content of ketone bodies in the blood.It is well known that ACC plays a crucial role in fatty acid oxidation by converting acetyl-CoA into malonyl-CoA, which in turn inhibits the CPT-1 activity and fatty acid transportation into mitochondria, thus reducing oxidation rates.Therefore, the reduced ACC levels may, at least in part, account for the increased fatty acid oxidation and energy expenditure inlnc_217knockdown mice.

The function of lncRNA is determined by its subcellular localization.In the cytoplasm, lncRNAs regulate the stability and translation of target mRNAs either directly or indirectly by utilizing microRNAs[29].In gastro-carcinoma cells, MSC-induced lncRNAsHCP5andMACC1-ASexerted anti-tumour effects by inhibiting the ability of microRNA to activate CPT-1 expression and β-oxidation[22,30].Within the nucleus,lncRNAs play a role in transcriptional regulation in some ways.Human-specificlncHR1is located in the nucleus and is involved in the transcriptional inhibition ofSREBP-1c[23].Several nuclear-expressed lncRNAs, such asMALAT1, do not affectSREBP-1ctranscription but alter protein shearing[31].Similar to gene expression, subcellular localization of lncRNAs is a dynamic process[32].In the current study, we found thatlnc_217was distributed mainly in the cytosol.The knockdown oflnc_217reduced SREBP-1c transcription and cleavage.In addition, genes involved in β-oxidation were significantly elevated at the transcriptional level.This finding implies thatlnc_217may be involved in the stability and translation of target mRNAs or that the subcellular localization oflnc_217may be altered.However, the specific mechanism remains unclear.In future studies, we will search for direct target genes oflnc_217through RNA pull-down and RNA-binding protein immuno precipitation experiments to better understand the molecular mechanism oflnc_217in regulating hepatic lipid metabolism and the development of NAFLD.

Taken together, the current study provides the first evidence thatlnc_217is closely involved in the regulation of hepatic lipogenesis and β-oxidation.The expression oflnc_217is increased in a variety of animal models of fatty liver, suggesting thatlnc_217is likely involved in the progression of NAFLD.The knockdown oflnc_217ameliorated HFD-induced hepatic steatosis and hyperlipidemia.The dual effects oflnc_217on fatty acid synthesis and β-oxidation makelnc_217an appropriate therapeutic target for NAFLD.Therefore, we have revealed a new molecular mechanism of lncRNA regulation of the hepatic fatty acid metabolism, which may pave the way for clinical treatments for NAFLD and dyslipidemia.

Fundings

This work was supported by grants from the National Natural Science Foundation of China (Grant Nos.32130050, 32201064, and 82170838), and the Natural Science Research Project of Universities in Jiangsu Province (Grant No.21KJB180003).

Acknowledgments

None.