Community Structure of Endophytic Fungi in Ginseng and Its Correlation Analysis with Active Components

Yaguang ZHANG, Yanxin ZHANG, Qi GAO

SPH Xing Ling Sci.& Tech.Pharmaceutical Co., Ltd., Shanghai 201703, China

Abstract [Objectives]The paper was to explore the correlation between active components of ginseng and community structure of endophytic fungi in ginseng under different cultivation methods.[Methods]Using ginsengs under two main planting patterns in Huanren County, Liaoning Province as the samples, the community structure of endophytic fungi was studied by molecular means, and the chemical components were identified and the content of chemical markers was measured via LC-MS.Moreover, the correlation between medicinal components of ginseng and diversity of endophytic fungal flora was analyzed.[Results]The diversity and active components of endophytic fungi of ginseng were different.The diversity analysis showed that the medicinal components of ginseng were positively correlated with some fungal groups in ginseng.[Conclusions]Artificial intervention in the planting process would affect the endophytic fungi in medicinal materials, and further affect the chemical components of ginseng medicinal materials.

Key words Forest ginseng, Cultivated ginseng, Active component, Endophytic fungi, Correlation analysis

1 Introduction

Ginseng is the dry root ofPanaxginsengC.A.Mey, and it is one of the traditional Chinese medicinal materials.ShengNong’sHerbalClassiclists ginseng as top grade and thinks it has the effect of replenishing vitality, tranquilizing the mind and promoting the intelligence.Modern clinical pharmacological studies have shown that ginseng plays a significant role in enhancing immunity, anti-tumor, and improving the function of cardiovascular[1-2].Due to different planting methods, ginseng is divided into forest ginseng and cultivated ginseng, with different price and efficacy.Currently, studies on genuine ginseng medicinal materials at home and abroad mainly focus on genetic diversity, pharmacological effects and ecological environment,etc.Plant internal environment, involving in a series of physiological and biochemical reactions, energy and substance metabolism, also plays an important role in the formation of genuine medicinal materials[3-4].Especially during the growth and development of medicinal materials, the accumulation of some secondary metabolites and effective medicinal components is closely related to the regulation mediated by internal fungi[5].

The ginseng harvested under artificial cultivation in the field is cultivated ginseng, which has short growth cycle and can be harvested in about 5 years.The planting method of forest ginseng is to broadcast the seeds in the mountains and wild forests and let them grow naturally.Generally, ginseng that grows for more than 15 years can also be called wild ginseng.It has certain practical significance for the guidance of ginseng cultivation method and quality control by revealing the differences between cultivated ginseng and forest ginseng from the perspective of the content of medicinal components and the community structure of endophytes.The application of chemical fertilizers and pesticides under artificial conditions will affect the physical and chemical properties of soil, thus changing the composition of soil microorganisms[6].During the growth process, plants will gradually form a symbiotic relationship with rhizospheric microorganisms, so there will be differences in endophytes between the two, indicating that the cultivation process of artificial intervention will also have an impact on the internal environment dominated by endophytes in medicinal materials[7].

The accumulation of some secondary metabolites and medicinal components in the growth and development of medicinal materials is directly related to the regulation mediated by internal microorganisms[8].In this study, the correlation between the endophytic fungi of ginseng and the main medicinal components of ginseng under two different cultivation methods was analyzed by LC/MS technology, in order to provide a research basis for the development and utilization of fungi in ginseng.The preliminary study of the microecosysteminvivocomposed of endophytic fungi and plants, as well as the differences and influences of the chemical components produced, will help to explain the formation mechanism of genuine ginseng medicinal materials from the internal environment[9].

2 Materials and methods

2.1 AgentsPlant DNA extraction kit, primer synthesis and Tap Mix enzyme were provided by Sangon Biotech(Shanghai)Co., Ltd.; methanol and acetonitrile were chromatographically pure purchased from Merck, Germany; ethanol, potato glucose agar and sodium hypochlorite were provided by Sinopharm Chemical Reagent Co., Ltd.The reference substances in the test, including ginsenoside Rg1(No.Z13O8L45576), Re(No.B10M8S35243), Rb1(No.Z16J9X52719), Rc(batch No.M18J9S53098), Rd(No.Z13N8X48155), Rg2(No.M17M8S31526), Rb2(No.P09M8F35575), Rf(No.P09M8F31017)and Rb3(No.Y05A8Y41182), were purchased from Shanghai Yuanye Biotechnology Co., Ltd.

2.2 MaterialsThis study was conducted in the Ginseng planting base in Huanren County, Liaoning Province(41°03′ N, 125°30′ W)in northeast China.A total of 10 fresh ginseng samples were used, and two groups were included according to planting methods, with five 5-year-old cultivated ginsengs and five forest ginsengs.Samples were randomly taken from five points in the center of the sampling area[10-11], with 5 parallel samples in each group.The roots were shaken to remove loose and adherent soil, and then rinsed until there were no visible soil particles on the roots.The roots were frozen and brought back to the laboratory for18S gene analysis of endophytic fungi[12].The research scope of plant symbiotic microorganisms in this study was defined as the endophytic fungi in the internal tissues of roots 1-3 cm below rhizome ginseng after removing the outer epidermis.

2.3 Sample processing and DNA extractionThe roots were shaken to remove loose and adherent soil, and the outer surface of the samples was cleaned with sterilized water in the ultra-clean table.The rhizome samples were cut into 10 mm×10 mm pieces with sterile blades.The internal tissue fragments of ginseng were first soaked in 75% ethanol solution for 1 min, then transferred to 5% sodium hypochlorite solution for 7 min, and finally soaked in 75% ethanol solution for 1 min[13].The surface-sterilized samples were rinsed with sterile water for 5 times and dried with sterile filter paper.Appropriate amount of samples were taken, and the internal tissues of treated samples were cut into pieces and placed in a mortar.After grinding with liquid nitrogen, the tissues were placed in 1.5 mL sterile tubes, and then genomic DNA was extracted by kit method.The quality and purity of DNA samples were detected by agarose gel electrophoresis and UV protein nucleic acid analyzer(Nano Drop One, GENEQUANT, Eppendorf).The concentration of nucleic acid was adjusted to 50 ng/μL with deionized water and stored at-80 ℃ for later use.

2.4 PCR amplification and product purificationThe DNA of test samples was obtained by the above gene extraction methods, and the amplification primers were synthesized for the 18S V5-V7 region of endophytic fungi and performed PCR amplification on each sample separately[14-15].The primers were 817F:(TTAGCATGGAATAATRRAATAGGA)and 1196R:(TCTGGACCTGGTGAGTTTCC).The endophytic fungi were amplified by PCR in the following procedures:(i)predenaturating at 95 ℃ for 5 min;(ii)denaturating at 95 ℃ for 35 s;(iii)annealing at 55 ℃ for 35s;(iv)extension at 72 ℃ for 50 s;(v)cycling 25 times from step(ii)to step(iv);(vi)extension at 72 ℃ for 5 min;(vii)termination at 4 ℃ for 10 min.The PCR was performed in an ABI ProFlex PCR thermal cycler.After amplification, the samples were purified by gel method, and examined.

2.5 High-throughput sequencing and analysisThe 18S region of each DNA amplified in PCR reaction was purified and recovered by 1.5% agarose gel method, and then sequenced by Shanghai Majorbio Bio-Pharm Technology Co., Ltd.[16].After filtering low-repeat sequences and chimerism, the operation taxon clustering of all the sequences was carried out, and the similarity of OTUs was 97%.Blastn was used to compare OTU sequences with Unite database one by one, and the comparison results were used for species annotation, and then the taxonomic map of species at the order level was constructed[17].The vegan package was used for principal component analysis(PCA), and Simpson diversity index was used for diversity analysis among samples[18].

2.6 Liquid chromatograph and mass spectrometry conditionsThe chromatographic conditions were as follows: Waters CORTECS C18(150 mm×4.6 mm, 2.7 μm), detection wavelength 203 nm, column temperature 30 ℃, injection volume 5 μL, flow rate 1.0 mL/min, phase A 0.1% formic acid-aqueous solution, phase B 0.1% formic acid-acetonitrile.The gradient elution procedures are shown in Table 1.

Table 1 Gradient elution schedule

Table 2 List of linear equations of main components

The mass spectrometry conditions were as follows: mass range of electrospray ionization(ESI)negative ion detection mode, 50-1200 Da; capillary voltage, 2.5 KV; sampling cone voltage, 30 V; source temperature, 120 ℃; desolvation temperature, 500 ℃; desolvation gas flow, 800 L/hr; cone gas flow, 50 L/hr; collision gas, argon; calibration liquid, 0.5 mM sodium formate, 2 ng/mL Leu-enkephaline(LE); the exact molecular weight of LE[M-H]-in the anion mode,m/z554.261 5; high collision energy channel, 10-40 eV energy gradient.

2.7 Determination of main components

2.7.1Sample preparation.The dry samples of forest ginseng were crushed and sieved by No.5 sieve(80 mesh).Accurately 2.00 g of sieved samples were weighed, and added with 20.00 mL of 70% methanol.After treated by ultrasonic sound(200 W, 40 KHz)for 100 min at 50 ℃, the solution was filtered, and the primary filtrate was discarded.Accurately 10.00 mL of subsequent filtrate was evaporated to dry by rotation.The residue was dissolved with 70% methanol and transferred to a 2 mL volumetric flask, then diluted with 70% methanol to the scale.The solution was shaken well and filtered through 0.22 μm membrane for later use.

2.7.2Plotting of standard curve.Accurately 1.00 mg of ginsenoside Rg1 reference, ginsenoside Re reference, ginsenoside Rb1 reference, ginsenoside Rc reference, ginsenoside Rd reference, ginsenoside Rb2 reference, ginsenoside Rb3 reference and ginsenoside Rg2 reference were weighed respectively, and dissolved in methanol to get 1.0 mg/mL reference solutions.Methanol was added to dilute sample step by step.The standard curves for determining the content of five kinds of ginsenosides were obtained with concentration as the ordinate and peak area as the abscissa.

2.8 Correlation analysis between community structure of endophytic fungi of Ginseng and ginsenoside contentThe data of secondary metabolites of ginseng were integrated, and the abundance data of endophytic fungi were sorted.The endophytic fungi data and ginsenoside data were statistically analyzed by the statistical software R language, forming a correlation heatmap and obtaining whether the correlation coefficient was significant(P<0.05).The three kinds of ginsenoside substances prescribed inChinesePharmacopoeia(Rg1, Re and Rb1)and two kinds of ginsenosides with high content(Rc and Rd)were selected for further analysis, which could be used to reflect the relationship with the top 50 species in abundance in the endophytic fungal community of ginseng.

3 Results and analysis

3.1 Pretreatment results and PCR amplification results

The genes extracted from samples were diluted to the same concentration and detected by agarose gel method, showing good gene integrity.PCR amplification, detection and analysis was conducted under appropriate conditions to ensure the accuracy of subsequent analysis results[19-20].Suitable concentration of products could be obtained after amplification of endophytic fungi(Fig.1).

Fig.1 Genomic DNA electrophoresis

3.2 Sequence statistics and diversity analysisThrough Miseq sequencing and cluster analysis of endophytic fungi of 10 ginsengs, a total of 522 303 effective sequences were obtained, which were clustered into OTUs according to 97% similarity.A total of 137 OTUs were obtained.Venn diagram represented the total number of OTUs in the sample group, and the two groups contained 103 and 87 OTUs, respectively(Fig.2).In order to compare the diversity of endophytic fungal communities of ginsengs from different habitats, the data of OTUs were standardized and organized according to minimum sequence number 44 146[21].The larger the Shannon and Chao indexes, the richer the diversity of fungal community in the sample.On the contrary, the larger the Simpson index, the smaller the diversity of fungal community in the corresponding sample.Group L was forest ginseng, and group R was cultivated ginseng.The diversity of Simpson index from high to low was L > R.As shown in Table 3, the diversity of endophytic fungi in cultivated ginseng was larger.

Fig.2 Venn diagram of OTUs distribution of endophytic fungal community in ginseng under different cultivation methods

Table 3 Diversity analysis of endophytic fungal community in ginseng

3.3 Analysis of relative abundance of endophytic fungi in ginsengThe taxonomic analysis diagram at the phylum level(Fig.3)showed that up to 70% of reads in the samples belonged toAscomycotafungi.Group L was forest ginseng, and group R was cultivated ginseng.The relative abundance of flora at the phylum level was different between the two groups of samples.The composition of endophytic fungi varied between forest ginseng and cultivated ginseng at the same age[16,22].The corresponding fungal taxa involved 7 phyla(Ascomycota, Basidiomycota, Mucoromycota, Ciliophora and some phyla with relatively low abundance), including 33 classes, 51 orders and 62 families[23].

Fig.3 Diversity of endophytic fungi in two groups of samples

3.4 Principal component analysis of endophytic fungi in ginsengGinseng samples under two different cultivation methods were conducted PCA analysis, and the similarity or difference of community composition among different groups of samples was explored through comparative analysis of species diversity among different habitats or microbial communities[24-25].The forest ginseng was located in the second and third quadrants, and the cultivated ginseng was located in the first and fourth quadrants.Clustering and PCA analysis showed that there were differences in endophytic fungal communities of ginseng under different cultivation methods(Fig.4).

Fig.4 PCA analysis of endophytic fungal structure in two groups of samples

3.5 Determination of chemical composition of ginsengThe determination results of chemical composition of ginseng are shown in Table 4.

3.6 Analysis of major chromatographic peaksGinsenosides are glycoside compounds composed of ginsengenin and sugar linked by-O-.Electrospray ionization(ESI)belongs to soft ionization.Ginsenosides usually have good ionization efficiency in ESI source under negative ion mode, thereby obtaining the relative mo-lecular weight information of compounds.UPLC-MSMS technology can provide abundant information for structural analysis of compounds.The fragmentation regularity of multistage mass spectrometry of ginsenosides showed that the glycosidic bond of ginsenosides was mainly broken under the action of collision energy, and the mass spectrometry gave the fragment ions of secondary glycosides and aglycones that lost one or more sugars, which further helped us to analyze ginsenosides.In this study, ginsenosides in the fingerprint of forest ginseng were analyzed based on the fragment ion information obtained in ESI(negative ion)detection mode, and the results are shown in Table 5.

Table 4 Determination results of chemical composition of ginseng %

Table 5 Identification results of common peaks of fingerprints of forest ginseng

3.7 Identification of forest ginseng and cultivated ginseng based on chemical composition of ginsengThe fingerprints of forest ginseng and cultivated ginseng were compared, and 33 common peaks were obtained.The peak areas of 33 common peaks were used as variables and imported into SIMCA-P 14.0 software for principal component analysis.The results obtained are shown in Fig.5.The results demonstrated that the samples of forest ginseng and cultivated ginseng were distributed on the left and right sides of the coordinate axis, indicating that there were quality differences.

Fig.5 Identification of forest ginseng and cultivated ginseng

3.8 Correlation analysis of chemical components and endophytic fungiAfter chemical composition detection, the contents of Rg1, Rb1 and Re in ginseng under two cultivation methods were higher than the ginsenoside standard inChinesePharmacopoeia(2020 edition).Rc and Rd were ginsenosides with relatively higher content in detection.In order to further analyze the endophytic fungi related to ginsenoside content, a multiple linear regression equation for the dominant genus of ginseng endophytic fungi and ginsenoside content under two cultivation methods was established by Spearman correlation analysis.The data were grouped and sorted for statistics, and the correlation coefficient was obtained(P<0.05).Finally, endophytic fungi were screened to build a correlation heat map(Fig.6).

Fig.6 Heat map of chemical components and endophytic fungi in ginseng

The correlation analysis of the top 50 fungi in abundance in ginseng endophytic fungi community with the active components contents of ginsenoside showed that some fungi groups were highly correlated with the five medicinal active components, especially the indicator components Rg1, Re and Rb1.Chaetomium,AspergillusandNucleariawere positively correlated with the contents of three medicinal ingredients Rg1, Re and Rb1 in ginseng in pharmacopoeia, whileAureobasidiumwere negatively correlated with the contents of Rg1, Rb1, Rc and Rd to some extent.These results indicated that there was a correlation between the community composition of endophytic fungi and the active components of ginsenosides.

4 Discussion

Plants are mutually symbiotic with microorganisms in their growing environment, some of which form close symbiosis.Some colonized fungi play important ecological functions in plants and play an important role in regulating the formation of secondary metabolites in plants, thus changing the adaptability of plants to the environment[26].In this study, cultivated ginseng and forest ginseng were closely related to different endophytic fungal communities.After sprouting and growing roots, seeds are preassembled into certain endophytic flora from themselves or the local soil environment, which is used to regulate internal metabolism and resist the invasion of alien microorganisms[27].Compared with the cultivated ginseng, the endophytic fungi of the same age forest ginseng contained more species and genetic diversity, and the relative abundance of the dominant four phyla of fungi was different between the two samples.The application of chemical fertilizer in the production of cultivated ginseng will introduce alien microorganisms, and the use of pesticides will affect the diversity of microorganisms in the soil environment.The seed source of forest ginseng and cultivated ginseng were the same, but the diversity of endophytes was different.This indicated that different cultivation environments would lead to differences in fungal composition.

Plant endophytes are microbial resources with great untapped potential.So far, many studies have proved that plant endophytes are closely related to the content of plant secondary metabolites.Some studies have found that the content of rare saponins can be increased by co-culture ofPaenibacilluspolymyxawith ginseng, which provides a way for the in-depth study of genuine medicinal materials[28-29].This paper aimed to study the difference of endophytic fungi between genuine medicinal materials and different quality medicinal materials, and analyze its population diversity and functional differences.The related factors of the formation of genuine medicinal materials could be explained from the perspective of endophytes.Meantime, it provided research data for solving the successive cropping obstacle of ginseng by restoring the original microbial community.Different growth environments of forest ginseng and cultivated ginseng affect the accumulation process of secondary metabolites.Through the accurate content quantification of five kinds of main ginsenosides and the comparison of other compounds, the differences between the two samples were revealed from the chemical content differences.LC/MS technology was used to further analyze the chemical components, so as to clarify the influence and correlation between plant endophytes and genuine medicinal materials, and to explore an effective way for the study of genuine medicinal materials.There are many species of endophytic fungi, and chemical composition of ginseng is complex and diverse.In this paper, the differences of ginseng under different cultivation methods were explained only from the correlation between ginsenosides and endophytic fungi.The more comprehensive material basis of ginseng, such as essential oil, polysaccharide and organic acid, can be further studied, in order to better understand the correlation between ginseng endophytes community and cultivation methods.