Effects of Jiawei Buzhong Yiqi Decoction on the Endometrial Receptivity of Rats with Polycystic Ovary Syndrome

Chen ZHAO, Chenggang LI

Hubei University of Medicine, Shiyan 442000, China

Abstract [Objectives] The study aims to discuss the effects of Jiawei Buzhong Yiqi Decoction on the endometrial receptivity of rats with polycystic ovarian syndrome (PCOS). [Methods] Adult female SD rats were selected and randomly divided into the model group and control group. In the model group, the PCOS model was established by using the method of Poretsky L. Rats in the control group were given physiological saline intervention at the same time. The successfully modeled rats were randomly divided into the PCOS group and traditional Chinese medicine group. Among them, rats in the Chinese medicine group were given Jiawei Buzhong Yiqi Decoction by gavage; rats in the model group and the control group were given normal saline for 14 d. All rats were killed by anesthesia after the last administration, and serum and uterine specimens were collected. Serum sex hormones (including T, E2, and P), glucose and insulin levels were detected; the equivalent diameter and area of endometrial gland and gland cavity, and the endometrial thickness of rats were measured; the expression of endometrial leukemia inhibitory factor (LIF), integrin αvβ3 protein and mRNA was detected by using Elisa and RT-PCR methods. [Results] The serum T, glucose, and insulin levels of rats in the PCOS group were significantly higher than those of the control group and the traditional Chinese medicine group, and there was no significant difference in the above indicators between the control group and the traditional Chinese medicine group; there was no significant difference in the E2 and P levels between the three groups. The equivalent diameter and area of endometrial gland and gland cavity, and the endometrial thickness of rats in the PCOS group were lower than those of the control group and the traditional Chinese medicine group; there was no significant difference in the above indicators between the traditional Chinese medicine group and the control group. The expression of LIF, integrin αvβ3 protein and mRNA in the endometrium of rats in various groups was basically the same. The expression of LIF and integrin αvβ3 in the endometrium of rats in the PCOS group was significantly lower than that of the control group and the traditional Chinese medicine group; there was no significant difference in the above indicators between the control group and the traditional Chinese medicine group. [Conclusions] The endometrial receptivity of PCOS rats was decreased; Jiawei Buzhong Yiqi Decoction can improve the endometrial receptivity of PCOS rats by increasing the expression of LIF and integrin αvβ3 in the endometrium.

Key words Jiawei Buzhong Yiqi Decoction, Polycystic ovary syndrome, Leukemia inhibitory factor, Integrin αvβ3

1 Introduction

Polycystic ovarian syndrome (PCOS), an endocrine disorder syndrome with multiple causes of occurrence and polymorphism of clinical manifestations, is mainly characterized by menstrual disorders, ovulation disorders, androgen hypertrophy, hyperinsulinemia and insulin resistance, and the incidence accounts for about 5%-10% of women of childbearing age[1]. The prominent problem of PCOS patients in childbearing age is reproductive disorders. Although rare ovulation and anovulation are common causes of infertility in PCOS patients, more and more evidence shows that decreased endometrial receptivity may also be one of the important reasons for the low pregnancy rate and high abortion rate of PCOS patients[2-4].

In recent years, traditional Chinese medicine has made great progress in the treatment of PCOS. While traditional Chinese medicine is clinically effective, it is non-destructive, non-invasive, safe and reliable, and has received increasing attention and recognition from the medical community. Clinical verification shows that Jiawei Buzhong Yiqi Decoction has a definite clinical effect in the treatment of PCOS, but the mechanism of action is still unclear. In this paper, the effects of Jiawei Buzhong Yiqi Decoction on the endometrial receptivity of PCOS rats were explored.

2 Materials and methods

2.1 Experimental animalsForty 24-day-old female SD rats (clean grade), weighing about 50 g, were selected, and the animals were fed in a standard animal room.

2.2 Experimental drugsJiawei Buzhong Yiqi Decoction was composed of ginseng 10 g, astragalus 10 g, atractylodes 30 g, licorice 6 g, angelica 10 g, cohosh 3 g, bupleurum 3 g, tangerine peel 10 g, poria cocos 18 g, and Pinellia 10 g. The original medicines were 110 g in weight, and were provided by the chinese pharmacy of Sinopharm Dongfeng General Hospital. They were decocted, filtered, and concentrated to 100 mL (each 1 mL of the decoction was equivalent to 1.1 g of crude drug) by the preparation room. The decoction was packed, sterilized, and stored at 4 ℃ for later use.

2.3 Grouping and processingAfter 3 days of adaptive feeding, all rats were divided into a model group (30 rats) and a control group (10 rats) using a random number table method. In the model group, the PCOS model was established according to the method of Poretsky L[5]. Each rat was injected with human chorionic gonadotropin (HCG) 1.5 u subcutaneously, bid*23 d; at the same time, each rat was injected with insulin (INS) on the 1st-11thd; the dosage increased from 0.5 to 6.0 u/d, and the dose was maintained until the 22ndd. 5% glucose solution was used to replace daily drinking water. Vaginal smears was performed when modeling, and the changes in the estrus cycle of rats was observed. From the vaginal smears, it is observed that vaginal keratinocytes continued to appear, and the complete estrus cycle was lost. 2 rats were randomly sacrificed. From the pathological section, if it was observed that the ovaries of the rats showed polycystic changes, the modeling was success. Meanwhile, rats in the control group were injected with the same amount of saline. The successfully modeled rats were randomly divided into PCOS group (14 rats) and traditional Chinese medicine group (14 rats). Rats in the traditional Chinese medicine group were given 3 mL/100 g of traditional Chinese medicine concentrate every day, twice a day for 14 consecutive days; rats in the control group and PCOS group were given equal volume of normal saline every day.

2.4 Observation indicators

2.4.1Serological determination. Radioimmunoassay was used to detect serum sex hormones (E2, P, and T), glucose and insulin levels.

2.4.2Histomorphological observation. Uterine paraffin-embedded sections were stained with HE, and endometrial morphology and microvessel density were observed under light microscope. Quantitative analysis was performed with HIMAS-200 high-definition color graphic analysis system to measure the equivalent diameter and area of uterine glands and gland cavity, and the average thickness of endometrium.

2.4.3Detection of the expression of endometrial leukemia inhibitory factor (LIF) integrin αvβ3 by ELISA. The operation steps were carried out in accordance with the instructions of the ELISA kit (the kit was purchased from CUSABIO). The sensitivity of the kit was 15 pg/mL. The maximum detection value of all samples shall not exceed 2 000 pg/mL. The coefficient of variation within and between groups of the kit did not exceed 9%.

2.4.4Detection of LIF and integrin αvβ3 mRNA expression in rat endometrium by RT-PCR. Total RNA was extracted from uterine tissue with Trizole reagent. By using reverse transcription kit (Wuhan Boster Biotechnology Company) and Oligo DT as primer, 1 μg of total RNA was taken for reverse transcription reaction, and then 50 ul of reaction system was used for PCR amplification. The LIF primer sequence is as follows: the upstream primer was ATCAAGAGTCAACTGGCTCAACTCA, and the downstream primer was TGTTGGGCGCACATAGCTTAT. The integrin αvβ3 primer sequence is as follows: the upstream primer was TTCAATGCCACCTGCCTCAA, and the downstream primer was TGAAGCATTCACCGTGTCTCCAA. All were synthesized by Takara Corporation of Japan. The relative quantitative 2-△△CTmethod was used to quantify the target gene.

3 Results and analysis

3.1 Comparison of serum sex hormones, glucose and insulin in each group of ratsAs shown in Table 1, the serum T level of rats in the PCOS group was significantly higher than that of the control group and the traditional Chinese medicine group. There was no significant difference in the T level between the control group and the traditional Chinese medicine group; there was no significant difference in the E2and P levels between the three groups. The serum glucose and insulin levels of rats in the PCOS group were significantly higher than those of the control group and the traditional Chinese medicine group. The glucose and insulin levels of rats in the traditional Chinese medicine group were slightly higher than those of the control group, and the difference was not statistically significant.

Table 1 Comparison of serum sex hormones, glucose and insulin levels in each group of rats

3.2 Morphological changes of the endometrium of rats in each groupThe endometrium of rats in each group was taken to compare the equivalent diameter and area of endometrial gland and gland cavity, the ratio of glandular interstitial area, and average endometrial thickness. As shown in Table 2, the equivalent diameter and area of endometrial gland and gland cavity, the ratio of glandular interstitial area, and average endometrial thickness of rats in the PCOS group were significantly lower than those of the control group and the traditional Chinese medicine group (P<0.01); The above indicators of the traditional Chinese medicine group were slightly lower than those of the control group, and the difference was not statistically significant (P=0.077).

3.3 Expression of LIF and integrin αvβ3 protein in the endometrium of rats in each groupAs shown in Table 3, compared with the control group, the expression of endometrial LIF and integrin αvβ3 protein in the PCOS group was significantly reduced (P<0.05); compared with the PCOS group, the expression of LIF and integrin αvβ3 in the Chinese medicine group was significantly increased (P<0.05).

Table 2 Morphological comparison of the endometrium of rats in each group

Table 3 Comparison of LIF and integrin αvβ3 protein content in the endometrium detected by Elisa pg/mL

3.4 Expression of LIF and integrin αvβ3 mRNA in the endometrium of rats in each groupCompared with the control group, the expression of LIF and integrin αvβ3 mRNA in the PCOS group was significantly reduced (P<0.05); compared with the PCOS group, the expression of LIF and integrin αvβ3 mRNA in the traditional Chinese medicine group was significantly increased (P<0.05) (Table 4).

Table 4 Comparison of LIF and integrin αvβ3 mRNA content in the endometrium detected by RT-PCR

4 Discussion

PCOS is a complex disease with reproductive endocrine disorders, and the important pathological changes that cause infertility include non-ovulation and poor oocyte quality. However, in recent years, many domestic and foreign studies have shown that decreased endometrial receptivity may be one of the important reasons for the low reproductive function and the high incidence of adverse pregnancy outcomes in PCOS patients.

Endometrial receptivity means that endometrial epithelial cells are ready to accept embryo implantation in terms of structure and function. A variety of specific molecular markers have been found to evaluate endometrial receptivity. The currently recognized markers of endometrial receptivity include steroid hormones and their receptors, integrin αvβ3, LIF,etc.Studies have shown that in the endometrial epithelial cells of PCOS patients during the implantation window, PR continues to be expressed, and it works with the increased ERα of the epithelial cell layer to suppresses the expression of integrin αvβ3, an adhesion molecule that plays an important role in the process of blastocyst implantation, resulting in a decrease in endometrial receptivity[6]. Savarisetal.studied the gene expression in the secretory endometrium of PCOS patients and women in normal childbearing age, and found that the expression of LIF and other genes regulated by progesterone in the endometrium of PCOS patients was significantly reduced, which may affect their endometrial receptivity[7]. In addition, progesterone plays an important role in the mid-secretory "implantation window". In PCOS patients, progesterone deficiency is caused by sparse ovulation or long-term anovulation, which affects the endometrial receptivity. In short, the complex metabolism and endocrine changes of PCOS break the homeostasis of endometrial tissue and lead to decreased endometrial receptivity[8].

The treatment of this disease in modern medicine is mainly to reduce androgen, regulate menstrual cycle, stimulate ovulation and so on. However, it only has a certain short-term effect for some patients, and drug resistance and ovarian hyperstimulation syndrome may occur. In addition, because the etiology and pathogenesis of PCOS are not yet clear, the treatment of PCOS by western medicine has stalled at the stage of symptomatic treatment, showing that the treatment by modern medicine is not yet satisfactory. In the treatment of PCOS, the treatment of obese PCOS is particularly tricky. Studies have shown that 30%-75% of patients with PCOS are obese[9]. Obesity can aggravate insulin resistance, hyperandrogenemia and glucose and lipid metabolism disorders in PCOS patients, and then increase the difficulty of PCOS treatment[10]. Therefore, seeking an effective treatment plan is an urgent problem to be solved at present. In recent years, traditional Chinese medicine has made great progress in the treatment of PCOS. While traditional Chinese medicine is clinically effective, it is non-destructive, non-damaging, safe and reliable. Traditional Chinese medicine compound has multi-channel, multi-step and multi-target effects. Therefore, based on the traditional theories of traditional Chinese medicine, combined with modern medicine’s understanding of the mechanism of the disease, comprehensive pharmacodynamic research and evaluation of representative prescriptions and treatments are of great significance for guiding the treatment of PCOS in the later stage. Traditional Chinese medicine believes that the superficial symptoms of the disease are phlegm dampness and blood stasis, which are caused by kidney deficiency, spleen deficiency, and liver depression. The main pathogenesis of obese PCOS is spleen deficiency and phlegm dampness. Traditional Chinese medicine believes that most obese people have deficiency of vital energy, and those with deficiency of vital energy have sputum. Studies have shown that 73.37% of obese people have phlegm-damp physique[11]. It can be seen that phlegm-damp physique is the main physique type of obese PCOS, and the main principle of treatment is drying dampness and resolving phlegm. Jiawei Buzhong Yiqi Decoction is derived from Fu Qingzhu Nvke, which is made from Buzhong Yiqi Decoction and Erchen Decoction. In the prescription, ginseng, astragalus, atractylodes, and licorice nourish the spleen, and angelica nourishes blood; tangerine peel, tuckahoe, and pinellia eliminate dampness.

In this study, the expression of LIF and integrin αvβ3 in the endometrium of PCOS rats was lower than that of normal rats, indicating that the endometrial receptivity of PCOS rats was decreased; after treatment with Jiawei Buzhong Yiqi Decoction, the expression of LIF and integrin αvβ3 in the endometrium of PCOS rats was increased, suggesting that Jiawei Buzhong Yiqi Decoction can improve the endometrial receptivity by increasing the expression of LIF and integrin αvβ3 in the endometrium of rats. Its mechanism of action may be realized by regulating the abnormal endocrine and metabolic state of the body.

About 59%-70% of PCOS patients have complex endocrine and metabolic abnormalities such as hyperandrogenemia, insulin resistance, and hyperinsulinemia[12]. These factors can affect endometrial receptivity in different ways. Insulin resistance and hyperinsulinemia can affect the glucose utilization of the endometrium. Studies have shown that the process of decidualization of the endometrial stroma requires more glucose intake, and glucose utilization disorders caused by insulin resistance can hinder the decidualization of endometrial stromal cells and then affect the formation of the receptive state of the endometrium[13]. A number of studies have shown that the expression of signal transduction molecules after the endometrial insulin receptor in PCOS patients with hyperinsulinemia decreases, thereby leading to abnormal endometrial glucose utilization in such patients to destroy endometrial receptivity[14-16]. Hyperandrogenemia is an important endocrine change in PCOS, which can directly damage the secretory function of the endometrium and cause a decrease in endometrial receptivity[17].

Modern pharmacological studies have shown that Erchen Decoction can lower blood sugar and improve insulin resistance[18]. In addition, clinical studies have shown that the components of Erchen Decoction can significantly reduce the body mass index, LH, LH/ FSH, androgen levels, blood sugar and insulin resistance of obese PCOS patients[19]. Other studies have confirmed that the serum insulin and androgen levels of phlegm-damp PCOS patients were significantly reduced after treatment with Xionggui Erchen Decoction[20]. Shi Xuguangetal.found that Buzhong Yiqi Decoction can regulate glucose metabolism and improve insulin resistance by reducing the GK level of glucose metabolizing enzyme in liver tissue[21]. Wu Meiyinetal.confirmed that Buzhong Yiqi Decoction can improve body energy metabolism, especially for the regulation of glucose metabolism[22]. In addition, Buzhong Yiqi Decoction can improve glycolipoprotein metabolism disorders in diabetic rats[23]. In this study, after PCOS rats were treated with Jiawei Buzhong Yiqi Decoction, the serum glucose, insulin and androgen levels were significantly reduced. Based on the above research, it is speculated that Jiawei Buzhong Yiqi Decoction may improve the endometrial receptivity of PCOS by regulating the abnormal endocrine state of PCOS, including regulating glucose and insulin metabolism, and reducing androgen levels.

To sum up, the endometrial receptivity of PCOS rats was decreased; Jiawei Buzhong Yiqi Decoction can improve the endometrial receptivity by increasing the expression of LIF,etc.in the endometrium of PCOS rats. This study provides a scientific experimental basis for the clinical application of Jiawei Buzhong Yiqi Decoction in the treatment of PCOS in Chinese medicine.