Effect of the Tiaobufeishen decoction on Caveolin-1-p38 MAPK signaling pathway and mechanism of improving the tracheobronchomalacia in chronic obstructive pulmonary disease

Peng-Cheng Zhou , Wei Yu, Ke-Ling Chen Wen-Jun Tang Wei Xiao Qian-Ming XiaJun-Mei Ma Yan Dong

1Department of Res 2piratory Medicine, Hospital of Chengdu University of Traditional Chinese Medicine,Chengdu, China. Clinical Medical School, Chengdu University of Traditional Chinese Medicine,Chengdu, China.

Introduction

With the development and progress of medical electrophysiology, patch clamp has received more and more attention. Whole-cell patch-clamp electrophysiological recording is a powerful technique for studying cellular function [1]. Chronic obstructive pulmonary disease (COPD) is a common disease which have the characteristic with persistent respiratory symptoms and airflow limitation performance, it can prevent by ourselves. Persistent respiratory symptoms and airflow limitation were caused by toxic particles or gases reduce the abnormal alveolar [1]. The world health organization expects the COPD to be the third leading cause of death worldwide and the fifth leading burden of disease worldwide by 2020 [1]. The last epidemiological investigation has shown that the prevalence of COPD in people over 40 years of age is as high as 13% in China [2-3]. With the aggravation of aging society and environmental pollution and other factors, the prevention and treatment of COPD in China is very difficult.

Tracheobronchomalacia is a pathological state caused by the degeneration and necrosis of airway cartilage caused by chronic inflammation and other factors, loss of supporting effect of tube wall, and rapid collapse of tube cavity due to the change of pressure inside and outside the chest (Figure 1) [4].

Figure 1 Tracheobronchomalacia

The clinical manifestation is repeated lung infection,accelerated deterioration of lung function and respiratory failure, or even sudden death, which has great harm. COPD is one of the most important causes of tracheobronchomalacia. The researches have shown that the detection rate of COPD combined with tracheobronchomalacia was as high as 53-59% [5-10]. Moreover, tracheobronchomalacia further accelerates the progression of COPD,therefore, it is great significance to improve the outcome of adverse events in COPD by improving or blocking tracheobronchomalacia.

At present, there is no better treatment for tracheobronchomalacia. It has been reported that airway stent implantation and airway plasty are effective for severe tracheobronchomalacia [11-15].However, stent placement can only resolve temporary airway collapse, and there are complications such as stent displacement, stent fracture, airway perforation and airway bleeding.Airway plasty often requires thoracotomy under general anesthesia, which is not only invasive, but also high risk and expensive, and is not suitable for patients with chronic pulmonary dysfunction of COPD.

COPD and tracheobronchomalacia were belong to“lung swell”, “gasp syndrome” in traditional Chinese medicine (TCM). Such as Lingshu (B.C. 475~221,Han Dynasty) said: lung swell causes cough. The 2011 edition of TCM guidelines for the diagnosis and treatment of COPD considered that the acute phase of the COPD mainly have the symptom of stagnation of phlegm; the stable phase of COPD center on Yin and Qi deficiency, the disease location was in the lung, spleen, and kidney, give priority to kidney.Therefore, tonifying lung and kidney is one of the main methods to treat COPD [16]. Kidney is the congenital foundation, it can store essential substances. Suwen said: bone marrow is produced by the kidney. The more the kidney essential produce,the strong the bone have. The normal growth of bone depends on the replenishment of essence and Qi in the kidney. Therefore, tracheobronchomalacia is closely related to kidney.

Most of research show that activation caveolin-1-p38MAPK signaling pathway plays an important role in lesion of the osteoarthritis chondrocytes [11-17]. Tiaobufeishen decoction could improve the regression of the osteoarthritis chondrocytes [18]. The clinical practice also shows that the method of tonifying lung and kidney can effectively improve the symptoms and quality of life of patients with tracheobronchomalacia with COPD.Therefore, this paper intends to reveal the improvement of the chondrogenic degeneration mechanism of COPD airway by using the caveolin-1-p38mapk signaling pathway, and to verify the relationship between this signaling pathway and COPD airway softening.

Method

Reagents and materials

Experimental materialRat airway chondrocytes(Procell CP-R087), Tianbufeishen decoction [Gusuibu (Rhizoma Drynariae), 15g;Sangjisheng (Herba Taxilli), 15g; Chuanniuxi (Radix Cyathulae), 10g; Huangqi (Radix Astragali seu Hedysari), 30g; Renshen (Radix Ginseng), 15g;Shudihuang (Radix Rehmanniae Preparata), 15g;Buguzhi (Fructus Psoraleae), 15g; Danshen (Radix Salviae Miltiorrhizae), 15g; Shanzhuyu (Fructus Corni), 15g; Xuduan (Radix Dipsaci), 15g;Zhebeimu (Bulbus Fritillariae Thunbergii), 10g;Aidicha (Herba Ardisiae Japonicae), 15g; Gancao(Radix Glycyrrhizae), 5g] was preparade of free-frying granules, rat dose was converted according to the equivalent dose conversion coefficient of human and rat (Convert coefficient: 6.3;Equivalent dose for rats = Effective human dose ×6.3). Add boiling water and mix well, after fully dissolved, cool, refrigerate and set aside, filter and remove bacteria when used. Flow cytometry was used to detect the apoptosis rate at 24h, appropriate concentrations were selected according to the experimental results.

Experimental method

GroupTo preliminarily verify the relationship between caveolin-1-p38mapk signaling pathway and bronchobronchomalacia associated with COPD, and to observe the effect of Tiaobufeishen decoction.This research included control group, model group,model-Tiaobufeishen group, model-blocker group.

COPD cell model(1) Preparation of cigarette smoke extract (CSE)：Light one filter tip cigarette with a continuous smoking drive, each cigarette was smoked for 5min and continuously attracted at a negative pressure of 5mlH2O (about 0.1kpa). The inhaled smoke passes through an inlet of the vacuum vessel into a suspension of 10mlPBS, the suspension was prepared at 1M NAOH PH7.4, the CSE solution was filtered by 0.22 m microporous membrane. The prepared CSE should be used for the experiment within 30min. Flow apoptosis explored the treatment concentration of CSE (0%, 2.5%, 10%, 20%, 30%,40%, 50%), and selected the appropriate concentration according to the experimental results.(2) COPD molding method. The purchased tracheal chondrocytes (Procell cp-r087) were treated with CSE for 48h to construct the COPD cell model [19].

COPD with airway chondrocyte degeneration modelAfter the successful establishment of COPD cell model, interleukin 10ng/ml 1 (IL-1β) was added to intervene for 24 hours. The chondrocyte degeneration was identified by toluidine blue staining and type II collagen immunohistochemical staining, and the subsequent detection was performed after the degeneration was successful.

Intervention methodThe control group was cultured with low glucose DMEM/1%FBS. On the basis of COPD cell model, the model group was treated with DMEM/1%FBS/10ng/ml IL-1β for 24 h,continue on normal medium for another 48 hours. In the blocker group, interleukin-low glucose DMEM/1%FBS/10ng/ml IL-1β was added after intervention for 30min, continue to intervene with blockers for 48 hours. In the TCM group,DMEM/1%FBS/10 ng/ml IL-1β was used for intervention for 24 hours, the medium containing TCM was changed for 48 hours, and then monitor the indicators.

Flow cytometryCollecting 1×106-3×106cell, add 1ml PBS and use 1500 rpm centrifuge for 3 min,attenuation the 5×Binding Buffer for 1×Binding Buffer used double distilled water. Take the precool Heavy suspension cells 300ul, Add 3 ul per tube Annexin V-FITC and 5ul PI-PE with slight blending,incubate in dark at room temperature for 10 min,then add the precool 1×Binding Buffer 200 μl in each tube, after blending, upflow meter detection.

ImmunohistochemistryIn the culture plate, the petri dish of cells were soaked with PBS for 3 times,every time 3 min. Fix with 4% paraformaldehyde for 15min, the petri dish was immersed in PBS for 3 times, every time 3 min. The petri dish was enriched with 3% fresh hydrogen peroxide to remove endogenous peroxidase blocking fluid, then incubate at room temperature for 10 min. 5%BSA was added to the culture dish and closed 30 min in 37 °C. A sufficient amount of diluted primary antibody was added to each petri dish 4°C incubation for the night.At last, take out 4 °C incubation petri dish, let stand at room temperature 45 min, PBS dip slides 3 times,each time 5 min. Add aggregation of HRP labeling two working liquid resistance, resistance to rabbit IgG 37 ° C for 30 min incubation, PBS elution fully;DAB color rendering for 5-10 minutes. Grasp the degree of staining under the microscope, wash with PBS or tap water for 1 min; Repeat dyeing with hematoxylin for 3 min. Hydrochloric acid alcohol differentiation; tap water was rinsed for 1 min, then dehydrated, transparent, sealed and examined under microscope.

Fluorogenic quantitative PCRRNA was extracted from each group of cells, after RNA extraction,cDNA was synthesized according to the reverse transcription kit, cDNA was used as template for fluorescence quantitative PCR. GAPDH was used as the internal parameter to calculate the relative expression of MMP3 in each group. (MMP3F:TTCCTTGGGCTGAAGATGAC; MMP3R:GATCCTGGAGAATGTGAGTGG; Caveolin-1F:CAAATGCCACTTTGCTCAGA; Caveolin-1R:ACAAAGCCATTTCCCAAGTG; GAPDHF:GCAAGTTCAACGGCACAG; GAPDHR:CGCCAGTAGACTCCACGAC)

Western blotEach group was added to the corresponding lysate, 4℃ cracking 30 min,centrifuge 10 min with 10000 rpm/min. Take care of the supernatant to get the total protein. Protein concentration was determined using BCA kit. Protein denaturation, loading, electrophoresis for 1 to 2 hours,turn wet membrane for 30-50 min. 4℃ incubation the 1st antibody (Rabbit monoclonal Anti - caveolin -1, Rabbit Polyclonal Anti - p - P38 lightning)solution for the night. Room temperature incubation 2nd antibody for 1-2 hours. Add ECL solution to the film and expose, quantity one software was used to analyze the gray value of each antibody band.

Statistical analysisSPSS 19.0 was used for

statistical analysis of all data, and X ± S was used for measurement data. T test the normality and homogeneity of variance, univariate anova was used for the comparison of multiple groups, with P < 0.05 as the significant difference.

Results

Rate of chondrocyte apoptosis for Tiaobufeishen decoction

On the scatter plot of flow cytometry, the living cells were located in the lower left quadrant and the early apoptotic cells were located in the lower right quadrant；The cell fragments in the upper left quadrant were mostly related to mechanical damage.The upper right quadrant shows advanced apoptotic cells. Annexin V FITC/PI double staining flow cytometry revealed an apoptosis rate of 8.34% in the blank group, The Tiaobufeishen decoction concentration of 1%, 5%, 10%, 15%, 20%, the apoptosis rate were 10.95%, 27.39%, 47.61%,49.27%, 66.04%. Among them, the apoptosis rate of tracheal chondrocytes was the lowest in 1%concentration of Tiaobufeishen decoction. Therefore,the optimal concentration of traditional Chinese medicine was determined to be 1% (Figure 2).

Figure 2 Rate of chondrocyte apoptosis for Tiaobufeishen decoction

Figure 3 Rate of chondrocytes at different concentrations of CSE

Figure 4 Toluidine blue staining

Flow cytometry was used to determine the apoptosis rate of chondrocytes at different concentrations of CSE

On the scatter diagram of flow analysis, living cells are located in the lower left quadrant, and early apoptotic cells are located in the lower right quadrant；The cell fragments in the upper left quadrant were mostly related to mechanical damage. The upper right quadrant shows advanced apoptotic cells.Annexin V FITC/PI double staining flow cytometry showed that the apoptosis rate of the blank group was 8.9%, 2.5%, 10%, 20%, 30%, 40%, 50%. The apoptosis rates of chondrocytes were 23.35%,83.95%, 88.33%, 77.25%, 90.69% and 85.99%,respectively. Compare to the control group, the apoptosis rates of CSE at different concentrations were statistically different. Among them, the apoptosis rate of tracheal chondrocytes was lowest at 2.5% CSE concentration. Therefore, 2.5%CSE was determined as the experimental concentration (Figure 3).

CCK8 was used to detect the effect of p38-mapk inhibitor on cell survival rate

p38-mapk inhibitor of 5umol/L, 10umol/L, 20umol/L,30umol/L and 50umol/L was used to treat tracheal chondrocytes for 24h, then added CCK8 to detect cell viability. The results showed that the survival rate of tracheal chondrocytes was lower than that of blank control group except for 10umol/L p38-mapk inhibitor, the difference was statistically significant,therefore, 10umol/L was selected as the experimental concentration (Table 1).

Toluidine blue staining

Figure 5 Immumohistochemical staining

Toluidine blue staining showed that in the normal control group, blue-purple allochromic granules were observed in chondrocytes, the nuclei were dark blue,a few pale blue allochromic granules were observed around the cells, and 1-2 nucleoli were clearly visible.The chondrocytes in the model group showed obvious pale staining, long and narrow cells, mostly monolayer growth, more vacuolar formation,nucleolar deformation, irregular cell morphology,and obvious cell degeneration. Chondrocytes in the model group + p38-mapk blocker group were stained deeply, some nuclei were thick, and a few vacuoles were observed in the cells, with uneven cell morphology and size. The cytoplasm of chondrocytes in the model group and the traditional Chinese medicine group was light blue with clear nucleoli and close to normal cell morphology. The results showed that chondrocyte degeneration could be improved in the blocker group and the prescription group (Figure 4).

Immumohistochemical staining

Immunohistochemical staining showed collagen typeⅡ antibody staining is stronger in the blank group,all of the cytoplasm are visible in the expression of collagen type Ⅱ. Model group Ⅱ type collagen expression decreased significantly, basic negative.Model + p38 lightning - MAPK blockers group can see Ⅱ expression of collagen type is abate, only a few cells expressed. Model + Chinese traditional medicine group Ⅱ expression of collagen type is abate, in more cartilage cytoplasm is visible. The results showed that chondrocyte degeneration could be improved in the blocker group and the prescription group (Figure 5).

Figure 6 The expressions of MMP3 and Caveolin-1 mRNA were detected by RT-PCR

Figure 7 Western caveolin-1 and p-p38 expression in chondrocytes of each group blot revealed

Table 1 Comparison of cell viability in different concentrations of P38-MAPK inhibitor ( s)

Table 1 Comparison of cell viability in different concentrations of P38-MAPK inhibitor ( s)

Note: One-way analysis of variance, P < 0.0001, F = 10.70; *Indicates compare with Control group, P < 0.05(Unpaired t test); a: Indicates compare with Control group, P = 0.0772.

Groups Cell viability Control group 100.0000 ± 1.74815 5umol/L 92.9754 ± 1.45461*10umol/L 97.3914 ± 2.28608a 20umol/L 96.2526 ± 1.81477*30umol/L 93.1276 ± 1.83695*50umol/L 94.9153 ± 1.81232*

The expressions of MMP3 and Caveolin-1 mRNA were detected by RT-PCR

The expression of MMP3 and Caveolin-1mRNA was lower in blank group, but the MMP3 and Caveolin-1mRNA were significantly increased in the model group. The expressions of MMP3 and Caveolin-1mRNA in model +p38-MAPK blocker group and model + TCM group were lower than model group, however, there was no statistical difference between the two groups. MMP3mRNA expression in model + p38-mapk blocker group and model + TCM group was higher than that in blank group, and the difference was statistically significant(Figure 6).

Western blot revealed caveolin-1 and p-p38 expression in chondrocytes of each group

Caveolin -1 and p-p38 protein were significantly increased in the model group. The expressions of caveolin-1 and p-p38 in model + p38-mapk blocker group and model + TCM group were lower than those of model group, and the differences were statistically significant, however, there was no statistical difference between the two groups. The expression of p-p38 in model + p38-mapk blocker group and model + TCM group was higher than that in blank group, and the difference was statistically significant (Figure 7).

Discussion

At present, the morbidity of the tracheobronchomalacia was unclear. Most of researchers considered that weasand chronic inflammation leads to degradation of tracheal or bronchial chondrocytes and matrix (Figure 8) [5-7].Masanori et al. consider that it related with emphysema [20]. However, Sverzellati et al. thought that there was no correlation between emphysema severity and airway softening, and there was statistical difference between airway wall thickness and emphysema severity, the thicker the wall, the more severe the softening [21]. Murgu Endoscopic ultrasonography showed that there were not only irregular thickening of cartilage rings, but also obvious thinning and relaxation of membrane tissue[22]. Therefore, the degeneration of tracheobronchial chondrocytes is the key pathology of airway softening.

Chondrocytes are pluripotent cells that not only synthesize and secrete the matrix, but also control the distribution of the extracellular matrix, collagen composition accounts for 50% to 70% of soft shaft weight, and GAG 20% to 40%, of which collagen is mainly type II collagen [23]. Chondrocyte matrix and extracellular matrix were significantly degraded in degenerative osteoarthritis [24]. Studies have shown that IL-1β can not only significantly reduce the synthesis of chondrocyte type II collagen and GAG,but also promote the synthesis and secretion of matrix metalloproteinases (MMPS), causing degradation of articular cartilage, it is an important inflammatory cytokine in the course of OA, IL-1β is often used as an inducer for chondrocyte degeneration [25]. Because 10ng/ml IL-1β induced chondrocyte degeneration is the best, we still used this concentration for tracheal chondrocyte degeneration in the experiment [26]. In this experiment, toluidine blue staining and immunohistochemistry showed that chondrocytes in the model group showed dedifferentiation. Some cells showed fusiform changes, less mitotic phase,intracellular vacuoles, decreased chondrocyte protein synthesis ability, significantly decreased type II collagen expression, and significant cell degeneration.The above changes were similar to those reported in the literature. Caveolaen was first identified by the Japanese scholar Yamada in 1955, when he used an electron microscope to look at the cytoplasmic membrane of the mouse gallbladder epithelium, and was initially thought to be involved in ion transport through the cell [27]. At present, three kinds of caveolin proteins have been found in mammals,which are caveolin-1, caveolin-2 and caveolin-3,Caveolin -1 is the major structural protein of Caveolae. The protein is now thought to be involved in age-related diseases such as emphysema and osteoarthritis [28]. Studies have shown that caveolin-1 of articular chondrocytes plays an important role in the activation of p38MAPK signal transduction pathway in chondrocytes, and is a key upstream signal molecule of p38MAPK [29]. Tang YQ et al. it was found that the degree of cartilage damage was positively correlated with caveolin-1 expression, moreover, IL-1β promoted the expression of caveolin-1 in chondrocytes in a time-dependent manner, which in turn induced the activation of p38MAPK signaling pathway, leading to increased degradation of type II collagen and proteoglycan in the cartilage matrix [30]. This study showed that caveolin-1 protein was significantly increased in both the intervention group and the model group compared with the control group, indicating that caveolin-1 was involved in the degeneration of tracheal chondrocytes in COPD model.

p38MAPK was discovered by Brewster et al. in 1993 when they studied the influence of extracellular hypertonic environment on yeast [31]. It is a tyrosine phosphorylated protein kinase with a molecular weight of 38KD, which can be activated by a variety of extracellular stimuli such as changes in the extracellular environment and pro-inflammatory factors, and is involved in a variety of physiological and pathological processes such as cell growth,differentiation, degeneration, aging and apoptosis[32]. In recent years, studies have found that the p38MAPK signaling pathway may be in a pivotal position in the destruction of articular cartilage,which is closely related to the maintenance and differentiation of chondrocyte phenotype,hypertrophy and calcification of chondrocytes,apoptosis, synthesis of chondromatrix metalloproteinase and production of chondroinflammatory cytokines [33, 34]. This study showed that compared with the blank control group,p38MAPK protein was significantly increased in each intervention group and model group, indicating that p38MAPK was involved in the degeneration of tracheal chondrocytes in COPD model.

MMPs is a series of metalloproteinases whose main function is to degrade the components of extracellular matrix, which can cause the destruction of cartilage matrix and further lead to the disorder of joint structure and function. MMP3 is a kind of matrix metalloproteinase, which plays an important role in matrix degradation [35]. Studies have found that osteoarthritis, IL-1β, TNF-a can induce up-regulation of MMPs expression, and p38MAPK signal transduction pathway is involved in this process [36]. Increased expression of MMPs leads to enhanced degradation of cartilage collagen. This study showed that compared with the control group,MMP3 was significantly increased in each intervention group and model group, indicating that MMP3 was involved in the process of tracheal chondrocyte degeneration in COPD model.

p38MAPK pathway blockers are commonly used in inflammatory and immune diseases, and they can inhibit the production of pro-inflammatory cytokines.There are a variety of them, and different inhibitors can specifically inhibit different members of the p38MAPK family [37, 38]. SB203580 is a powerful selective inhibitor of p38MAPK with little effect on ERKs and JNKs pathways [39]. Studies have shown that SB203580 can prevent the apoptosis of chondrocytes and cartilage degeneration in nitric oxide induced rat osteoarthritis model, and play a role in cartilage protection [40]. Therefore,SB203580 was selected as the inhibitor of p38MAPK signaling pathway in this study. The results showed that compared with the model group, SB203580 blocker group could significantly down-regulate the expressions of caveolin-1, p-p38 and MMP3, so as to reduce the degeneration of tracheal chondrocytes,which was consistent with the literature reports.

In this study, the tracheal chondrocytes were treated with 2.5%CSE to make COPD cell model,then 10ng/ml IL-1β was added to induce COPD related airway chondromalacia model. Results were compared with the control group, Caveolin-1,p38MAPK, and MMP3 level significantly increased in the model group, toluidine blue staining and immunohistochemistry showed marked degeneration of chondrocytes；the expressions of caveolin-1,p38MAPK and MMP33 in the model + blocker group were significantly lower than those of the model group, chondrocyte degeneration was markedly reduced. Our results suggest that IL-1β can activate caveolin-1-p38mapk signaling pathway,leading to the occurrence of COPD bronchobronchomalacia, specific blocking of this pathway can alleviate airway chondrocyte degeneration.

TCM has stable and reliable curative effect on COPD and is one of the important means to prevent COPD in China. Tiaobufeishen decoction is one of the basic methods for the treatment of COPD, which is described in detail in the 2011 edition of TCM guidelines for the diagnosis and treatment of COPD.The study showed that the method had the effect of multi-target control. Li Y et al. observed the effects of Tiaobufeishen decoction on collagen and matrix metalloproteinases in lung tissues of COPD rats. The results showed that the method of Tiaobufeishen decoction can reduce the thickening of bronchial wall and blood vessel wall [41]. It can improve airway remodeling and injury, 3 months after drug withdrawal effect still exists. The mechanism related to reduce the lung tissue Ⅰ, Ⅲ, Ⅳ collagen deposition, reduce the expression of matrix metalloproteinases (MMPS), increase matrix metalloproteinases inhibitor. Tian YG et al. Through the study of JAK/STAT signaling pathway, it is discovered that the method can significantly reduce the expression of JAK, STAT and other proteins and genes in COPD, and enhance the expression of cytokine signal transduction inhibitory factor (SOCS),thus reducing the lung tissue injury. Our experimental results also indicate that Tiaobufeishen decoction can down-regulate the expressions of caveolin-1, p38MAPK, and MMP3 in COPD combined with bronchobronchiomalacia model, so as to reduce the degeneration of airway chondrocytes.

This study was the first to elucidate the mechanism of tracheobronchomalacia in COPD from caveolin-p38mapk signaling pathway, at the same time, it is the first time to reveal the target of Tiaobufeishen decoction in improving bronchobronchomalacia, the level of TCM in the prevention and treatment of COPD was improved.This study also has some limitations. Due to limited funds, only the key indicators of the upstream and downstream parts of the signaling pathway were observed. Therefore, the experimental results cannot fully explain the mechanism of Tiaobufeishen recipe,and whether there are other signaling pathways or networks that lead to COPD associated bronchobronchomalacia needs further study, which will be our next direction.

Conclusions

Caveolin-1-p38MAPK signal pathway plays an important role in the tracheobronchomalacia with COPD, Tiaobufeishen decoction could blocking this signal pathway so that improve the regression of airway chondrocyte degeneration.

1. Global strategy for the diagnosis, Management and prevention of chronic obstructive pulmonary disease. (2018 Report).

2. Wang C, Xu J, Yang L, et al. Prevalence and risk factors of chronic obstructive pulmonary disease in China (the China Pulmonary Health [CPH]study): a national cross-sectional study. Lancet 2018, 391: 1706-1717.

3. Expert group on diagnosis and treatment of acute exacerbation of chronic obstructive pulmonary disease (AECOPD). Chinese expert consensus for the diagnosis and treatment of acute exacerbation of chronic obstructive pulmonary disease (AECOPD) (Revised 2014). Int J Respir 2014, 34: 1-11.

4. Lee KS, Sun MRM, Ernst A, et al. Comparison of dynamic expiratory CT with bronchoscopy for diagnosing airway malacia: a pilot evaluation.Chest 2007 Mar, 131: 758-764.

5. Heussel CP, Ley S, Biedermann A, et al.Respiratory lumenal change of the pharynx and trachea in normal subjects and COPD patients:assessment by cine-MRI. Eur Radiol 2004, 14:2188-2197.

6. Loring SH, O'donnell CR, Feller-Kopman DJ, et al. Central airway mechanics and flow limitation in acquired tracheobronchomalacia. Chest 2007,131: 1118-1124.

7. Sverzellati N, Rastelli A, Chetta A, et al. Airway malacia in chronic obstructive pulmonary disease: prevalence, morphology and relationship with emphysema, bronchiectasis and bronchial wall thickening. Eur Radiol 2009, 19:1669-1678.

8. O' Donnell CR, Bankier AA, O' Donnell DH.Static end-expiratory and dynamicforced expiratory tracheal collapse in COPD. Clin Radiol 2014, 69: 357-362.

9. Inoue M, Hasegawa I, Nakano K, et al.Incidence of tracheobronchomalacia associated with pulmonary emphysema: detection with paired inspiratory-expiratory multidetector computed tomography using a low-dose technique. Jpn J Radiol 2009, 27: 303-308.

10. Septimiu MURGU, Noricki KURIMOTO, Henri COLT. Endobronchial ultrasound morphology of expiratory central airway collapse. Respirology 2008, 13:315-319.

11. Ernst A, Odell DD, Michaud G, et al. Central airway stabilization for tracheobronchomalacia improves quality of life in patients with COPD.Chest 2011, 5: 1162-1168.

12. Majid A, Guerrero J, Gangadharan S.Tracheobronchoplasty for severe tracheobronchomalacia: a prospective outcome analysis. Chest 2008, 134: 801-807.

13. Popilevsky F, Al-Ajam MR, Ly V, et al. Dynamic Y stent fractures in crescentic tracheobronchomalacia. J Bronchology Interv Pulmonol 2012, 19: 206-210.

14. Zhou PC, Xia QM, Li XL, et al. Clinical analysis of chronic obstructive pulmonary disease with tracheobronchomalacia. Chin J Lung Dis(Electronic Edition) 2016, 9: 320-321.

15. Zhou PC, YU W, Li XL, et al. The treatment of airway stent placement in chronic obstructive pulmonary disease with severe bilateral main tracheobronchomalacia. Chin J Lung Dis 2016, 9:676-678.

16. The professional committee of pulmonary diseases of internal medicine of chinese society of traditional Chinese medicine. Guidelines for TCM diagnosis and treatment of chronic obstructive pulmonary disease. J Tradit Chin Med 2012, 53: 80-84.

17. Dai SM, Shan ZZ, Nakamura H, et al. Catabolic stress induces features of chondrocyte senescence through overexpression of caveolin 1:possible involvement of caveolin 1-induced down-regulation of articular chondrocytes in the pathogenesis of osteoarthritis. Arthritis Rheum 2006 Mar, 54: 818-831.

18. Su YY, Yan H, Chen BJ, et al. Effect of naringin of drynaria rhizome, a Chinese medical component of Zhuanggu Jianxi recipe containing serumon caveolin-p38MAPK signal pathway in IL-1βInduced rabbit degenerated chondrocytes.Chin J Integr Tradit West Med 2014, 34:1492-1498.

19. Zeng Z, He S, Lu J, et al. MicroRNA-21 aggravates chronic obstructive pulmonary disease by promoting autophagy. Exp Lung Res 2018 Mar, 44: 89-97.

20. Inoue M, Hasegawa I, Nakano K, et al.Incidence of tracheobronchomalacia associated with pulmonary emphysema: detection with paired inspiratory-expiratory multidetector computed tomography using a low-dose technique. Jpn J Radiol 2009, 27: 303-308.

21. Sverzellati N, Rastelli A, Chetta A, et al. Airway malacia in chronic obstructive pulmonary disease: prevalence, morphology and relationship with emphysema, bronchiectasis and bronchial wall thickening. Eur Radiol 2009, 19:1669-1678.

22. Septimiu MURGU, Noricki KURIMOTO, Henri COLT. Endobronchial ultrasound morphology of expiratory central airway collapse. Respirology 2008, 13: 315-319.

23. Carballo CB, Nakagawa Y, Sekiya I, et al. Basic science of articular cartilage. Clin Sports Med 2017 Jul, 36: 413-425.

24. Rahmati M, Nalesso G, Mobasheri A, et al.Aging and osteoarthritis: central role of the extracellular matrix. Ageing Res Rev 2017, 40:20-30.

25. Feng Z, Li X, Lin J, et al. Oleuropein inhibits the IL-1β-induced expression of inflammatory mediators by suppressing the activation of NF-κB and MAPKs in human osteoarthritis chondrocytes. Food Funct 2017, 8: 3737-3744.

26. Mao G, Wu P, Zhang Z, et al. MicroRNA-92a-3p regulates aggrecanase-1 and aggrecanase-2 expression in chondrogenesis and IL-1β-Induced catabolism in human articular chondrocytes. Cell Physiol Biochem 2017, 44: 38-52.

27. Yamada E. The fine structure of the renal glomerulus of the mouse. J Biophys Biochem Cytol 1955, 1: 551-566.

28. Zou H, Stoppani E, Volonte D, et al. Caveolin-1,cellular senescence and age-related diseases.Mech Ageing Dev 2011, 132: 533-542.

29. Julia P, Maria IG, Maria D PC, et al. Paracrine effects of human adipose-derived mesenchymal stem cells in inflammatory stress-induced senescence features of osteoarthritic chondrocytes. Aging 2016, 8: 1703-1717.

30. Tang YQ, Dang ZZ, Dai MS, et al. Enhanced expression of caveolin-1 in articular chondrocytes in osteoarthritis. Natl Med J Chin 2008, 88: 1493-1497.

31. Brewster JL, Valoir T, Dwyer ND, et al. An osmosensing signal transduction pathway in yeast. Sci 1993, 259: 1760-1763.

32. Bonney EA. Mapping out p38MAPK. Am J Reprod Immunol 2017, 77: 5.

33. Li Z, Meng D, Li G, et al. Celecoxib combined with diacerein effectively alleviates osteoarthritis in rats via regulating JNK and p38MAPK signaling pathways. Inflammation 2015, 38:1563-1572.

34. Sun HY, Hu KZ, Yin ZS. Inhibition of the p38-MAPK signaling pathway suppresses the apoptosis and expression of proinflammatory cytokines in human osteoarthritis chondrocytes.Cytokine 2017, 90: 135-143.

35. Cui N, Hu M, Khalil RA. Biochemical and biological attributes of matrix metalloproteinases.Prog Mol Biol Transl Sci 2017, 147: 1-73.

36. Xu K, Ma C, Xu L, et al. Polygalacic acid inhibits MMPs expression and osteoarthritis via Wnt/β-catenin and MAPK signal pathways suppression. Int Immunopharmacol 2018, 63:246-252.

37. Zhu S, Luo H, Liu H, et al. p38MAPK plays a critical role in induction of a pro-inflammatory phenotype of retinal Müller cells following Zika virus infection. Antiviral Res 2017, 145: 70-81.

38. Wang L, Li B, Quan MY, et al. Mechanism of oxidative stress p38MAPK-SGK1 signaling axis in experimental autoimmune encephalomyelitis(EAE). Oncotarget 2017, 8: 42808-42816.

39. Duzgun SA, Yerlikaya A, Zeren S, et al.Differential effects of p38 MAP kinase inhibitors SB203580 and SB202190 on growth and migration of human MDA-MB-231 cancer cell line. Cytotechnology 2017, 69: 711-724.

40. Zhou Y, Liu SQ, Yu L, et al. Berberine prevents nitric oxide-induced rat chondrocyte apoptosis and cartilage degeneration in a rat osteoarthritis model via AMPK and p38 MAPK signaling.Apoptosis 2015, 20: 1187-1199.

41. Li Y, Wang YY, Li JS, et al. Influence and long-term effect of therapy of regulating and supplementing lung and kidney on collagen and matrix metalloproteinase in lung tissue in COPD rats. J Beijing Univ Tradit Chin Med 2012, 35:615-619.

42. Tian YG, Li Y, Li JS, et al. Impact and long-term effect of three prescriptions regulating and tonifying lung and kidney on JAK/STAT signaling in rats. Chin J Chin Mater Med 2013,38: 75-79.