Construction of Arabidopsis thaliana ugt84a2/ugt84a4 Double Mutants Mediated by CRISPR/Cas9

Xiumei GONG, Xuelin WU, Kaixuan ZHOU, Wei ZHAO, Yuanyuan SUN, Shaojie SANG, Guizhi ZHANG, Jundong HE

Abstract [Objectives] The CRISPR/Cas9 （Clustered regulatory interspaced short palindromic repeat/Cas9） gene editing technology is the third generation of "genome fixed-point editing technology" following the "zinc finger endonuclease （ZFN）" and "transcription activator effector nuclease （TALEN）". Glucotransferase genes UGT84A2 and UGT84A4， can simultaneously convert hydroxycinnamate into 1-O-β-glucose esters as isozymes. The CRISPR/Cas9 technology was used to construct double mutants of Arabidopsis thaliana ugt84a2/ugt84a4.

[Methods] A CRISPR/Cas9 double mutant expression vector was constructed using UGT84A2 and UGT84A4 as the target genes. The Agrobacterium-mediated dip dyeing method was used to transform wild-type A. thaliana， and the CRISPR/Cas9 system was used to target and knock out A. thaliana UGT84A2 and UGT84A4 genes.

[Results] The descendants of A. thaliana with the UGT84A2/UGT84A4 gene were sequenced and analyzed. Thirteen positively transformed plants obtained were analyzed according to the sequencing results， and the ugt84a2/ugt84a4 double mutants were screened.

[Conclusions] This study provides a reference for the functional study of UGT84A2 and UGT84A4 isoenzyme genes in other species， as well as strong theoretical and method support for accelerating the development and utilization of UGT84A2/UGT84A4 functional gene resources.

Key words CRISPR/Cas9; Arabidopsis thaliana; ugt84a2/ugt84a4; Gene knockout; Double mutant

Received： April 5， 2022  Accepted： June 9， 2022

Supported by Natural Science Foundation of Shandong Province （ZR2017PC007）; Project of Shandong （Linyi） Institute of Modern Agriculture of Zhejiang University for Serving Local Economic Development （ZDNY-2020-FWLY02007）; Doctoral Program of China West Normal University （18Q051）.

Xiumei GONG （1998-）， female， P. R. China， master， devoted to research about molecular biology.

*Corresponding author. E-mail： guizhizhang11@163.com; jundhe@163.com.

Arabidopsis thaliana， as a model plant， contains numerous glycosyltransferases （GT; EC 2.4.x.y）， which can catalyze the transfer of glycosyl groups from activated donor molecules to acceptor molecules[1]. The donor molecules of glycosyl groups are diverse， and in addition to common sugars， sugar phosphates， nucleoside phosphate sugars and uridine diphosphateglucuronic acid， there are uridine diphosphate-xylose， uridine diphosphate-rhamnose， uridine diphosphate-galactose， etc.[2-3]. Glycosylation modification is common in plants， and glycosyltransferases catalyze this modification reaction. It connects activated sugars to different receptor molecules， such as proteins， nucleic acids， oligosaccharides， lipids and small molecules， forming glycosides or sugar esters. It is generally believed that glycosylation modification changes the biological activity， water solubility， stability， intracellular and whole plant transport properties， subcellular localization， and mutual recognition and binding properties with signaling receptors of receptor molecules. Glycosylation modification can also reduce or remove the toxicity of endogenous and exogenous substances. It can be seen that glycosylation modification affects many aspects of plant growth and development， and is an important mechanism for regulating cellular metabolic balance[4-5].

A. thaliana glycosyltransferases were the first to be used to study evolution[6]， and a common feature of UGT84A2 and UGT84A4 is that the glycosyltransferases they encode both catalyze the formation of glucose esters[7]. Meanwhile， studies have shown that the glycosyltransferases UGT84A2 and UGT84A4 can convert hydroxycinnamate to 1-O-β-glucose esters， and these two genes can modulate the response of A. thaliana to UV-B by participating in phenylpropanoid metabolism in A. thaliana. Semi-quantitative reverse transcription-polymerase chain reaction （RT-PCR） showed that exposure of plants to UV radiation for 10 h triggered transcriptional induction of genes encoding UGT84A2 and UGT84A4 in A. thaliana leaves. Measurements found that UGT84A2 and UGT84A4 had high transcription levels[8]， which shows that UGT84A2 and UGT84A4 are isozymes.

Current studies also show that UGT84A2 can glycosylate auxin indole butyric acid， and the overexpression of A. thaliana auxin glycosyltransferase UGT84A2 can increase indole-3-butyric acid and inhibit the transcription of ARF6， ARF8 and flowering-related genes FT， SOC1， AP1 and LFY to delay flowering， resulting in the agronomic traits of increased rosette leaf number at flowering and/or longer petiole during the vegetative growth stage[9]. Flowering time is an important agronomic trait in crop production， and the implementation of this study will bring significant economic benefits to agricultural production[10]. However， due to redundant gene functions， single mutants did not show obvious phenotypes， and it is necessary to knock out the isozyme genes for further functional studies.

To further investigate the function of ugt84a2/ugt84a4， it would be a suitable research strategy to construct a double mutant[11]. CRISPR/Cas9 （clustered regularly interspaced short palindromic repeats/CRISPR associated systems） is an adaptive virus defense system derived from prokaryotes. In nature， when a virus invades an individual， the CRISPR system expresses Cas protein and guide RNA complementary to the viral genome， and the guide RNA guides the Cas protein to bind to corresponding viral genome to cut DNA， thereby playing a defensive role[12]. Three different CRISPR/Cas systems from bacteria have been found in nature. Among them， the type II CRISPR/Cas system is the most thoroughly studied. Its Cas9 protein assists the processing of pre-crRNA to mature crRNA， and then binds it to a specific genomic DNA sequence under the guidance of crRNA complementary pairing， cleaving the double-stranded genomic DNA sequence to form DSB. After in-depth research and development， the type II CRISPR/Cas system has been successfully applied to the genome editing technology[13]. In this study， ugt84a2/ugt84a4 double mutants of A. thaliana were constructed by the CRISPR/Cas9 technology. This study provides a reference for the functional study of UGT84A2 and UGT84A4 isozyme genes in other species， as well as strong theoretical and methodological support for accelerating the development and utilization of ugt84a2/ugt84a4 functional gene resources.

Experimental Materials and Methods

Experimental materials

A. thaliana plants were placed in an A. thaliana culture room in this experiment （culture conditions： temperature 25 ℃， photoperiod 16 h light/8 h dark）. Escherichia coli DH5α competent cells， Agrobacterium GV3101 competent cells， CRISPR/Cas9 vector， Taq enzyme， T4 DNA ligase， DNA Marker 2 000 bp， DNA recovery kit， plasmid extraction kit， and other materials and reagents were preserved in the laboratory. Primer synthesis was performed by Sangon Biotech （Shanghai） Co.， Ltd.

Experimental methods

Design of sgRNA target primers

The A. thaliana UGT84A2 and UGT84A4 gene sequences （AT3G21560 and AT4G15500， respectively） were searched in the NCBI database， and the UGT84A2 and UGT84A4 target sequences were designed using the sgRNA design system （CRISPR-P）. The designed UGT84A2 and UGT84A4 target sequences were synthesized to Oligo（5′-3′）UP according to 5′TGATT+forward target sequence， and to Oligo（5′-3′）LW according to 5′AAAC+reverse target sequence. The target sequences and synthesized sequences are shown in Table 1.

Preparation of Oligo dimers

First， UGT84A2 and UGT84A4 Oligo dimers were prepared according to Table 2 with a reaction system of 20 μl. After the Oligo dimers were prepared， PCR was performed. The reaction program was started with denaturation for 3 min at 95 ℃， which was then slowly decreased to 20 ℃ at about 0.2 ℃/s， and the system was finally diluted to 100 μl with water.

Construction of CRISPR/Cas double-mutant vector

The first step was to prepare the reaction system according to Table 3. The reaction was performed at 25 ℃ for 1 h （the system could be stood overnight at 4 ℃）. The second step was to transform the competent cells. Specifically， 20 μl of DH5α competent cell was taken out from the -80 ℃ freezer， and placed on ice until thawed. Then， 5 μl of the above reaction solution was added to DH5α competent cells， and the system was mixed and stood in ice bath for 30 min （without shaking）. The mixture was gently taken out， subjected to thermal shock at 42 ℃ for 35 s， and rapidly placed on ice for 2 min. Next， 100 μl of LB medium was added， followed by incubation at 37 ℃ for 1 h with shaking. Next， 100 μl of bacterial liquid was spread on a LB plate with 50 μg/ml Kan， which was then inverted overnight at 37 ℃. The colonies were picked and cultured overnight in 5 ml of LB liquid medium containing 50 μg/ml Kan. The plasmids were extracted using a plasmid extraction kit， and verified by enzyme digestion. Correct plasmids were picked for sequencing verification. The third step was plasmid extraction. The transformants were verified by colony PCR with primers PUV4-R and PUV3-F （Table 4）. The correct positive transformants were then shaken， and plasmids were extracted using plasmid mini-kit and sent to the company for sequencing. The positive transformants that were verified to be correct were stored at -80 ℃. After the candidate positive clones were identified correctly by enzyme digestion， and 10 μl of the correct plasmid was transferred into Agrobacterium competent GV3101 and spread on LB medium （containing 50 μg/ml rifampicin and 50 μg/ml kan）， and after culturing upside down at 28 ℃ for 2 d， single clones were picked for verification and used for the next step of dip staining.

Agrobacterium-mediated transformation of A. thaliana

First， dried wild-type （WT） A. thaliana seeds were sterilized in 1.5 ml Eppendorf centrifuge tubes. The sterilized seeds were evenly spread into MS solid medium， which was then sealed with parafilm and placed in a 4 ℃ refrigerator for dark treatment， and the seeds were vernalized for 3 d.  After 3 d， the medium was placed in an A. thaliana culture room （culture conditions： temperature 25 ℃; photoperiod 16 h light/8 h dark）. After one week of culture， A. thaliana was transferred to vermiculite containing MS nutrient solution and continued to be cultured （culture conditions： temperature 25 ℃; photoperiod 16 h light/8 h dark） until it grew to about 3 weeks， about 20 cm high， and siliques were cut with scissors in preparation for dip dyeing.

The monoclonal positive bacterial liquid containing the target gene plasmid was activated.  Then， 10 μl of ugt84a2/ugt84a4 Agrobacterium GV3101 was added to 5 ml of LB liquid medium， which was then added with 5 μl of kanamycin and 5 μl of rifampicin， and the obtained mixture was cultured at 28 ℃ for one day at 160 r/min. The next day， the activated bacterial liquid was subjected to expanding culture， and 10 μl of the activated bacterial liquid was added to 10 ml of LB liquid medium， which was then added with 10 μl of kanamycin and 10 μl of rifampicin. The bacteria were cultured at 160 r/min and 28 ℃ for 1-2 d. The liquid was shaken until the OD value was about 0.8. Next， 1 ml of the expanded bacteria liquid was added into a 1.5 ml Eppendorf centrifuge tube， which was centrifuged at 12 000 rpm for 1 min， and the supernatant was discarded. The cells were re-suspended in freshly prepared transformation solution （containing 5% sucrose， 0.02% Silwet L-77）. The wild-type A. thaliana plants with the siliques cut off were dipped， and the transformation droplets were drawn onto the A. thaliana stigmas with a pipette， so that the dipping liquid was wrapped on the stigmas. Dipping operation was performed once at an interval of 20 min， for a total of three times. The dyed A. thaliana was dark-treated for 1 d， and the same method was performed at an interval of one week in order to improve the transformation rate. After the seeds were mature， the seeds of the T1 generation were harvested. After drying， the seeds of the T1 generation were sterilized according to the above steps， spread on the MS medium containing hygromycin （hygromycin∶MS=1∶1 000）， and placed in the dark place of the refrigerator at 4 ℃ for 3 d of vernalization. After 3 d， the medium was placed in an A. thaliana culture room at 25 ℃ （16 h light culture， 8 h dark culture）， and positive seedlings were screened.

Detection of mutant homozygotes

The above-mentioned positive seedlings were transferred into vermiculite containing MS nutrient solution to continue culturing to obtain T1 generation plants. The T1 generation plants were numbered T1-1， T1-2…T1-13， and 1-2 leaves were cut from each plant， and extracted for genomic DNA by the SDS method， and the target fragment was amplified by PCR using amplified UGT84A4 primers， with wild-type A. thaliana as a control. The PCR reaction program was started with pre-denaturation at 94 ℃ for 2 min， followed by 30 cycles of denaturation at 94 ℃ for 30 s， annealing at 55 ℃ for 30 s and extension at 72 ℃ for 45 s， and completed with extension at 72 ℃ for 5 min. The PCR reaction system was 20 μl， containing primers YZ84A4P1 and YZ84A4P2 0.5 μl each， extracted genomic DNA 4 μl， water 5 μl， and Taq enzyme 10 μl. Then， 4 μl of PCR product was detected by 1% gel electrophoresis， and compared with the bands run out with 2 000 bp Marker under the same condition. The target band was about 400 bp， and the PCR product with a band of about 400 bp was sent to Biosune Biotechnology （Qingdao） Co.， Ltd. for further verification. The seeds of the mutated T1 generation plants were planted to obtain the plants of the T2 generation， which was numbered， and their leaves were cut to extract the genome. This time， the amplified UGT84A4 primers YZ84A2P1 and YZ84A2P2 were used to amplify the target band around 470 bp. The rest of the steps were the same as the T1 generation. The T3 generation was obtained by planting A. thaliana seeds with mutations in UGT84A4 in the T1 generation and UGT84A2 in the T2 generation. For the T3 generation， whether UGT84A2 and UGT84A4 were mutated at the same time should be tested. Those who were mutated at the same time and whose mutation situation was the same as the previous generation were the homozygotes desired.

Results

Selection of sgRNA target sequence

The A. thaliana UGT84A2 and UGT84A4 gene sequences （AT3G21560 and AT4G15500， respectively） were searched in the NCBI database. GACGAAGAAGTGGATTAACG was selected as the target sequence for UGT84A2， and UGT84A2 primers YZ84A2P1 and YZ84A2P2 were synthesized following the forward primer Oligo （5′-3′） UP and reverse primer Oligo （5′ -3′） LW format. The primers YZ84A4P1 and YZ84A4P2 of UGT84A4 were synthesized in the same way. The primer sequences are shown in Table 4.

Vector construction and verification

First， the primer Oligo dimers of the sgRNA target sequence were denatured for 3 min at 95 ℃， which was then slowly lowered to 20 ℃ at about 0.2 ℃/s for annealing and pairing ligation.  Then， ligation with the linearized CRISPR/Cas vector was performed at 25 ℃ for 1 h. After the reaction， PCR verification was carried out. The PCR band of the positive transformants of UGT84A2 was 470 bp （Fig. 1）， and that of the PCR band of the positive transformants of UGT84A4 was 400 bp （Fig. 2）. Thus， a CRISPR/Cas vector with targeting sequences of UGT84A2 and UGT84A4 were constructed. The target genes amplified by PCR was further sent to the company for sequencing verification， and the verification results were completely consistent with the gene sequence results published by NCBI.

Screening and detection of A. thaliana double mutants

Screening and detection of A. thaliana double mutant ugt84a4 chimeras of the T1 generation

In Agrobacterium-mediated transformation of A. thaliana， Agrobacterium carrying the recombinant double mutant vector to infect A. thaliana to obtain the plants of the T0 generation， which were screened by hygromycin to obtain 13 positive seedlings of the T1 generation， which were numbered as T1-1， T1-2， T1-3…T1-13. The genomic DNA of the 13 seedlings of the T1 generation was extracted and amplified by PCR using primers 84a4-F and 84a4-R （Table 1）. The amplified products were sent to the company for sequencing analysis. The sequenced sequences were compared with the sequence of wild-type A. thaliana plants， obtaining Table 5 and Fig. 3.

Screening and detection of double mutant ugt84a4 homozygotes of A. thaliana in the T1 generation

The ugt84a4 mutants T1-11 and T1-12 that had been verified in the T1 generation were selected to be screened by hygromycin to obtain the T2 generation plants， and 8 plants were selected for each number， obtaining T2-11-1， T2-11-2…T11-7， T2-11-8， and T2-12-1， T2-12-2…T2-12-7， T2-12-8， respectively. The genomic DNA of the 16 seedlings of the T2 generation was extracted and amplified by PCR using primers 84a4-F and 84a4-R （Table 1）. The amplified products were sent to the company for sequencing analysis. The sequenced sequences were compared with the sequence of wild-type A. thaliana plants， obtaining Table 6 and Fig. 4.

Screening and detection of ugt84a2/ugt84a4 double mutants of A. thaliana in the T3 generation

After Agrobacterium-mediated transformation and hygromycin screening of positive seedlings， the transformed plants of the T1 generation were obtained. The leaves of 13 seedlings of the T1 generation were cut and their genomic DNA was extracted by the SDS method. PCR was carried out with the designed primers YZ84a4P1 and YZ84a4P2 （Table 4）， and then the amplified PCR products was run for electrophoresis detection. The products with a target band of about 400 bp were sent to the company for sequencing analysis. The sequenced sequences were compared with the gene sequence of the wild-type A. thaliana plants to analyze the sequencing results. Among the 13 positively transformed A. thaliana plants， T1-1， T1-2， T1-3…T1-11 and T1-13 lacked an A base， and T1-12 lacked A and G bases， which caused gene frameshift mutation， thus forming mutants of UGT84A4.

The seeds of the verified mutant T1-11 of the T1 generation were screened by hygromycin to obtain the plants of the T2 generation. Eight plants were transferred and planted for each number， labeled as T2-11-1， T2-11-2…T2-11-8， and genomic DNA was extracted from the T2 generation of No. 11. Primers Yz84a2P1 and Yz84a2P2 were designed （Table 4） for PCR， and the amplified products were sent to the company for sequencing analysis. Compared with the wild-type A. thaliana plants， the sequencing results were observed and analyzed to found that T2-11-1 of No. 11 lacked the CGTTAA fragment. The seeds of T2-11-1 were dried and screened by hygromycin to obtain the T3 generation， which were marked as T3-11-1-1， T3-11-1-2…T3-11-1-8. The DNA of the plants of the T3 generation was extracted and amplified by PCR using primers （Table 1）. The amplified products were sent to the company for sequencing analysis. After sequencing， it was found that the four UGT84A4 plants T3-11-1-1， T3-11-1-2， T3-11-1-7 and T3-11-1-8 were the same as the T1 generation lacking the A base. The mutation types of UGT84A2 in the T3 generation are shown in Table 7 and Fig. 5.

Discussion

CRISPR-Cas9 is an adaptive immune defense system formed during the long-term evolution of bacteria and archaea， which can be used to fight against invading viruses and foreign DNA.  The CRISPR-Cas9 gene editing technology is a technology for specific DNA editing of targeted genes[14-16]. The CRISPR-Cas9 technology can cover most regions of genes， and has the advantages of low cost， convenient operation and high efficiency. It is the third generation of "genome site-directed editing technology" following "zinc finger endonuclease （ZFN）" and "transcription activator-like effector nuclease （TALEN）". The gene editing technology can realize the "editing" of target genes， and realize the knockout and addition of specific DNA fragments， etc. Compared with the previous two generations of technologies， the biggest breakthrough of CRISPR-Cas9 technology is that it can not only edit a single gene， but more importantly， it can edit multiple genes at the same time， which also provides an effective method for genome-wide screening[17-19].

CRISPR/Cas9 produces wild plants， heterozygous mutants， biallelic mutants， and homozygous mutants， and only biallelic mutants and homozygous mutants are useful. Therefore， if the first-generation transgene fails to obtain biallelic mutants or homozygous mutants， it is necessary to screen the biallelic mutants and homozygous mutants from the progeny through continuous selfing， reguiring large screening workload. In this study， a CRISPR/CaS9 double mutant vector was obtained by concatenating multiple mutants at the same time to construct ugt84a2/ugt84a4 double mutants. In the screening process， when the UGT84A4 gene of the T1 generation was detected first to screen the chimeras of ugt84a4， and the ugt84a2 mutants were screened on this basis， which reduced a lot of workload.

Isozyme genes are ubiquitous in plants， for example， in A. thaliana， the glycosyltransferases UGT76C1 and UGT76C2， which catalyze the N-glycosylation of cytokinin， and the glycosyltransferase UGT85A1， UGT73C5 and UGT73C1， which catalyze the O-glycosylation of cytokinin[20]. Cytokinins in maize include two members， cis-ZOG1 and cis-ZOGT2[11-22]. In rice， cytokinin glycosyltransferases include three members， cZOGT1， cZOGT2， and cZOGT3[23].  It also leads to the condition that a single knockout of a gene in multiple isogenes often leads to no obvious phenotype， thus affecting the study of the function of a certain gene. In this study， UGT84A2 and UGT84A4 can convert hydroxycinnamate to 1-O-β-glucose esters， and these two genes can regulate the response of A. thaliana to UV-B by participating in phenylpropanoid metabolism in A. thaliana as isozymes. At present， the research on UGTT84A2 and UGT84A4 is still in the single mutant research， and the research on the double mutants will be of great significance to understanding the functions of the two enzymes. Meanwhile， this study provides a reference for the functional study of UGT84A2 and UGT84A4 isoenzyme genes in other species.

References

[1] PAQUETTE S， MLLER BL， BAK S. On the origin of family 1 plant glycosyltransferases[J]. Phytochemistry， 2003， 62 （3）： 399-413.

[2] VOGT T， JONES P. Glycosyltransferases in plant natural product synthesis： Characterization of a supergene family[J]. Trends Plant Sci， 2000， 5 （9）： 380-386.

[3] JONES P， VOGT T. Glycosyltransferases in secondary plant metabolism： Tranquilizers and stimulant controllers[J]. Planta， 2001， 213 （2）： 164-174.

[4] ZHAO QJ， CHENG Y， WANG J， et al. Advances in the use of glycosyltransferases in glycoside synthesis[J]. Journal of Beijing University of Chemical Technology： Natural Science Edition， 2018， 45 （5）： 92-99. （in Chinese）.

[5] WEIS M， LIM EK， BRUCE NC， et al. Engineering and kinetic characterisation of two glucosyltransferases from Arabidopsis thaliana[J]. Biochimie， 2008， 90 （5）： 830-834.

[6] Lim EK， Li Y， PARR A， et al. Identification of glucosyltransferase genes involved in sinapate metabolism and lignin synthesis in Arabidopsis[J]. J Biol Chem， 2001， 276 （6）： 4344-4349.

[7] JONES P， MESSNER B， NAKAJIMA JI， et al. UGT73C6 and UGT78D1， glycosyltransferases involved inflavonol glycoside biosynthesis in Arabidopsis thaliana[J]. J Biol Chem， 2003， 278 （45）： 43910-43918.

[8] KEIKO YS， FUKUSHIMA A， NAKABAYASHI R， et al. Two glycosyltransferases involved in anthocyanin modification delineated by transcriptome independent component analysis in Arabidopsis thaliana[J]. Plant J， 2012， 69 （1）： 154-167.

[9] WANG B， JIN SH， HU HQ， et al. UGT87A2， an Arabidopsis glycosyltransferase， regulates flowering time via flowering locus C[J]. New Phytol， 2012， 194 （3）： 666-675.

[10] LI D， LEWIS RS， JACK AM， et al. Development of CAPS and dCAPS markers for CYP82E4， CYP82E5v2 and CYP82E10 gene mutants reducing nicotine to nornicotine conversion in tobacco[J]. Mol Breeding， 2012， 29 （3）： 589-599.

[11] HSU PD， LANDER ES， ZHANG F. Development and applications of CRISPR-Cas9 for genome engineering[J]. Cell， 2014， 157 （6）： 1262-1278.

[12] MARRAFFINI LA， SONTHEIMER EJ. Self versus non-self discrimination during CRISPR RNA-directed immunity[J]. Nature， 2010， 463 （7280）： 568-571.

[13] LEI JF， XU XX， LI Y， et al. Identification of GGB mutant caused by CRISPR/Cas9 in Arabidopsis[J]. Acta Botanica Boreali-Occidentalia Sinica， 2016， 36（5）： 857-864. （in Chinese）.

[14] SHI J， YANG YJ， GUAN CP.  Identification of knockout of MS2 gene mutant in Arabidopsis mediated by CRISPR/Cas9[J]. Molecular Plant Breeding， 2018， 16 （16）： 5323-5328. （in Chinese）.

[15] ZHENG W， GU F. Progress of application and off-target effects of CRISPR/Cas9[J]. Hereditas， 2015， 37（10）： 1003-1010. （in Chinese）.

[16] RAZZAQ A， SALEEM F， KANWAL M， et al. Modern trends in plant genome editing： An inclusive review of the CRISPR/Cas9 toolbox[J]. Int J Mol Sci， 2019， 20 （16）： 4045.

[17] GAJ T， GERSBACH CA， BARBAS III CF. ZFN， TALEN， and CRISPR/Cas-based methods for genome engineering[J]. Trends in Biotechnology， 2013， 31 （7）： 397-405.

[18] BANNIKOV AV， LAVROV AV. CRISPR/CAS9， the king of genome editing tools[J]. Mol Biol （Mosk）， 2017， 51 （4）： 582-594.

[19] HOU BK， LIM EK， HIGGINS GS， et al. N-glucosylation of cytokinins by glycosyltransferases of Arabidopsis thaliana[J]. Journal of Biological Chemistry， 2004， 279 （46）： 47822-47832.

[20] MARTIN RC， MOK MC， HABBEN JE， et al. A maize cytokinin gene encoding an O-glucosyltransferase specific to cis-zeatin[J]. PNAS， 2001， 98 （10）： 5922-5926.

[21] VEACH YK， MARTIN RC， MOK DWS， et al. O-glucosylation of cis-zeatin in maize. Characterization of genes， enzymes， and endogenous cytokinins[J]. Plant Physiol， 2003， 131（3）： 1374-1380.

[22] KUDO T， MAKITA N， KOJIMA M， et al. Cytokinin activity of cis-zeatin and phenotypic alterations induced by overexpression of putative cis-Zeatin-O-glucosyltransferase in rice[J]. Plant Physiol， 2012， 160（1）： 319-331.